Incidental Mutation 'R5931:Clca2'
ID461829
Institutional Source Beutler Lab
Gene Symbol Clca2
Ensembl Gene ENSMUSG00000036960
Gene Namechloride channel accessory 2
SynonymsClca5
MMRRC Submission 044126-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5931 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location145070263-145099443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 145092125 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 193 (V193G)
Ref Sequence ENSEMBL: ENSMUSP00000143161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040465] [ENSMUST00000198993]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040465
AA Change: V193G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036029
Gene: ENSMUSG00000036960
AA Change: V193G

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
VWA 309 485 3.55e-5 SMART
low complexity region 739 754 N/A INTRINSIC
Blast:FN3 765 875 5e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000198993
AA Change: V193G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143161
Gene: ENSMUSG00000036960
AA Change: V193G

DomainStartEndE-ValueType
Pfam:CLCA_N 7 265 1.7e-121 PFAM
VWA 309 485 2.2e-7 SMART
Pfam:DUF1973 494 674 7.8e-75 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the calcium-activated chloride channel regulator (CLCR) family of proteins. Members of this family regulate the transport of chloride across the plasma membrane. Expression of this gene is upregulated by the tumor suppressor protein p53 in response to DNA damage. Mice lacking a functional copy of this gene exhibit increased liver weight and hepatocyte hypertrophy. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit increases in liver weight to body weight ratio and hepatocyte hypertrophy; one incidence of multifocal hepatic necrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Cyld A G 8: 88,729,842 probably null Het
Dbt A T 3: 116,523,425 E83D possibly damaging Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dgkg G A 16: 22,558,038 R524* probably null Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Eif2b2 C T 12: 85,222,787 T211I probably damaging Het
Ep400 A G 5: 110,735,520 probably benign Het
Ermp1 C G 19: 29,615,729 A788P probably benign Het
Ern1 A G 11: 106,426,873 S142P possibly damaging Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Fndc3a A T 14: 72,568,867 S444T probably benign Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lpar6 A G 14: 73,238,928 I110V probably damaging Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tenm3 A T 8: 48,646,498 S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Trim69 A T 2: 122,178,594 K378N probably damaging Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Vps4b T C 1: 106,777,335 I343V probably benign Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Clca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Clca2 APN 3 145098813 missense probably damaging 1.00
IGL01337:Clca2 APN 3 145095178 missense probably damaging 1.00
IGL01389:Clca2 APN 3 145077868 critical splice donor site probably null
IGL01595:Clca2 APN 3 145088007 missense probably damaging 1.00
IGL01704:Clca2 APN 3 145095218 missense probably benign 0.04
IGL02416:Clca2 APN 3 145085016 missense probably benign 0.02
IGL02455:Clca2 APN 3 145081411 missense probably benign 0.00
IGL02481:Clca2 APN 3 145084940 missense possibly damaging 0.92
IGL02526:Clca2 APN 3 145088018 missense probably benign 0.02
IGL02797:Clca2 APN 3 145081263 missense probably benign 0.02
IGL03253:Clca2 APN 3 145071563 missense probably benign 0.41
IGL03256:Clca2 APN 3 145086392 missense possibly damaging 0.75
IGL03294:Clca2 APN 3 145097769 missense probably damaging 1.00
3370:Clca2 UTSW 3 145077977 missense probably damaging 1.00
R0479:Clca2 UTSW 3 145090849 missense probably damaging 1.00
R0542:Clca2 UTSW 3 145075810 splice site probably benign
R0629:Clca2 UTSW 3 145072239 missense probably benign
R1488:Clca2 UTSW 3 145084164 missense possibly damaging 0.49
R1523:Clca2 UTSW 3 145071644 nonsense probably null
R1568:Clca2 UTSW 3 145075649 nonsense probably null
R1650:Clca2 UTSW 3 145092212 missense probably damaging 1.00
R1771:Clca2 UTSW 3 145081410 missense probably benign 0.12
R2101:Clca2 UTSW 3 145077938 missense probably damaging 0.99
R2242:Clca2 UTSW 3 145090790 missense probably damaging 0.98
R3751:Clca2 UTSW 3 145071455 missense probably benign 0.04
R4496:Clca2 UTSW 3 145092165 missense possibly damaging 0.94
R4962:Clca2 UTSW 3 145077879 missense probably damaging 1.00
R5344:Clca2 UTSW 3 145087942 missense probably damaging 1.00
R5424:Clca2 UTSW 3 145084181 missense probably damaging 0.99
R6181:Clca2 UTSW 3 145090708 nonsense probably null
R6598:Clca2 UTSW 3 145086485 nonsense probably null
R7167:Clca2 UTSW 3 145097784 missense probably benign 0.40
R7229:Clca2 UTSW 3 145084108 missense probably damaging 1.00
R7256:Clca2 UTSW 3 145090847 missense probably damaging 0.99
R7365:Clca2 UTSW 3 145098784 missense probably damaging 1.00
X0025:Clca2 UTSW 3 145086504 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGAATTTTCTCCTTGCTATATGGGC -3'
(R):5'- TGTCTTCACTGACCAGCAAG -3'

Sequencing Primer
(F):5'- TGTGGACAAAGCTGACCTTG -3'
(R):5'- TTCACTGACCAGCAAGGCCTG -3'
Posted On2017-02-28