Incidental Mutation 'R5931:Tenm3'
ID461847
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Nameteneurin transmembrane protein 3
SynonymsTen-m3, Odz3, 2610100B16Rik
MMRRC Submission 044126-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R5931 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location48227682-48843951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48646498 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 91 (S91T)
Ref Sequence ENSEMBL: ENSMUSP00000033965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840] [ENSMUST00000211812]
Predicted Effect probably benign
Transcript: ENSMUST00000033965
AA Change: S91T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: S91T

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000190840
AA Change: S91T
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: S91T

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211812
AA Change: S91T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Clca2 A C 3: 145,092,125 V193G possibly damaging Het
Cyld A G 8: 88,729,842 probably null Het
Dbt A T 3: 116,523,425 E83D possibly damaging Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dgkg G A 16: 22,558,038 R524* probably null Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Eif2b2 C T 12: 85,222,787 T211I probably damaging Het
Ep400 A G 5: 110,735,520 probably benign Het
Ermp1 C G 19: 29,615,729 A788P probably benign Het
Ern1 A G 11: 106,426,873 S142P possibly damaging Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Fndc3a A T 14: 72,568,867 S444T probably benign Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lpar6 A G 14: 73,238,928 I110V probably damaging Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Trim69 A T 2: 122,178,594 K378N probably damaging Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Vps4b T C 1: 106,777,335 I343V probably benign Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48235607 missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48293657 missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48276156 missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48343316 missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48417179 missense probably benign 0.05
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1863:Tenm3 UTSW 8 48276346 missense probably benign 0.20
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48417006 critical splice donor site probably null
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48674550 missense probably benign 0.17
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2237:Tenm3 UTSW 8 48342337 missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48278961 nonsense probably null
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48235826 missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48417059 missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense probably benign 0.00
R7140:Tenm3 UTSW 8 48292236 missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48300969 missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48235935 missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48236177 missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48236183 missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48287812 missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48276600 missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48341049 missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48335727 missense probably benign 0.27
R7734:Tenm3 UTSW 8 48646333 missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48236465 missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48276300 missense probably benign 0.01
R7843:Tenm3 UTSW 8 48229111 nonsense probably null
R7926:Tenm3 UTSW 8 48229111 nonsense probably null
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48276780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAAACAGTGCGACTTACCG -3'
(R):5'- CAGACATGGGTGAAGCCTGAAC -3'

Sequencing Primer
(F):5'- AGTTGGACCGGCTTGACAG -3'
(R):5'- AGCCTGAACGAATGAGTGTTTC -3'
Posted On2017-02-28