Incidental Mutation 'R5931:Mcm3ap'
ID461857
Institutional Source Beutler Lab
Gene Symbol Mcm3ap
Ensembl Gene ENSMUSG00000001150
Gene Nameminichromosome maintenance complex component 3 associated protein
SynonymsGANP
MMRRC Submission 044126-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5931 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location76468927-76515857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76471166 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 371 (V371A)
Ref Sequence ENSEMBL: ENSMUSP00000125960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049185] [ENSMUST00000170795]
Predicted Effect probably benign
Transcript: ENSMUST00000049185
SMART Domains Protein: ENSMUSP00000045647
Gene: ENSMUSG00000033126

DomainStartEndE-ValueType
Pfam:UPF0054 8 148 7.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170795
AA Change: V371A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125960
Gene: ENSMUSG00000001150
AA Change: V371A

DomainStartEndE-ValueType
Pfam:NupH_GANP 2 286 3.3e-108 PFAM
low complexity region 389 403 N/A INTRINSIC
Blast:RRM 430 504 5e-39 BLAST
SCOP:d1fjeb2 434 500 6e-4 SMART
low complexity region 544 559 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
Pfam:SAC3_GANP 677 903 1.7e-82 PFAM
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1024 1035 N/A INTRINSIC
low complexity region 1039 1053 N/A INTRINSIC
low complexity region 1091 1110 N/A INTRINSIC
low complexity region 1133 1155 N/A INTRINSIC
Pfam:CID_GANP 1156 1226 1.6e-33 PFAM
Pfam:MCM3AP_GANP 1254 1967 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218564
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The minichromosome maintenance protein 3 (MCM3) is one of the MCM proteins essential for the initiation of DNA replication. The protein encoded by this gene is a MCM3 binding protein. It was reported to have phosphorylation-dependent DNA-primase activity, which was up-regulated in antigen immunization induced germinal center. This protein was demonstrated to be an acetyltransferase that acetylates MCM3 and plays a role in DNA replication. The mutagenesis of a nuclear localization signal of MCM3 affects the binding of this protein with MCM3, suggesting that this protein may also facilitate MCM3 nuclear localization. This gene is expressed in the brain or in neuronal tissue. An allelic variant encoding amino acid Lys at 915, instead of conserved Glu, has been identified in patients with mild intellectual disability. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele die by E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Clca2 A C 3: 145,092,125 V193G possibly damaging Het
Cyld A G 8: 88,729,842 probably null Het
Dbt A T 3: 116,523,425 E83D possibly damaging Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dgkg G A 16: 22,558,038 R524* probably null Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Eif2b2 C T 12: 85,222,787 T211I probably damaging Het
Ep400 A G 5: 110,735,520 probably benign Het
Ermp1 C G 19: 29,615,729 A788P probably benign Het
Ern1 A G 11: 106,426,873 S142P possibly damaging Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Fndc3a A T 14: 72,568,867 S444T probably benign Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lpar6 A G 14: 73,238,928 I110V probably damaging Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tenm3 A T 8: 48,646,498 S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Trim69 A T 2: 122,178,594 K378N probably damaging Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Vps4b T C 1: 106,777,335 I343V probably benign Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Mcm3ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Mcm3ap APN 10 76471177 missense probably benign 0.01
IGL00742:Mcm3ap APN 10 76492935 missense probably damaging 1.00
IGL00898:Mcm3ap APN 10 76470325 missense probably benign 0.00
IGL00984:Mcm3ap APN 10 76499566 missense probably damaging 1.00
IGL01591:Mcm3ap APN 10 76470805 missense probably benign
IGL01882:Mcm3ap APN 10 76483184 missense possibly damaging 0.71
IGL01973:Mcm3ap APN 10 76471117 missense probably benign 0.00
IGL02253:Mcm3ap APN 10 76470065 missense probably benign 0.40
IGL02304:Mcm3ap APN 10 76484738 missense possibly damaging 0.65
IGL02340:Mcm3ap APN 10 76496552 nonsense probably null
IGL02487:Mcm3ap APN 10 76507555 unclassified probably benign
IGL02488:Mcm3ap APN 10 76499649 missense probably damaging 1.00
IGL02640:Mcm3ap APN 10 76506421 missense probably damaging 1.00
IGL02714:Mcm3ap APN 10 76511033 missense probably benign 0.00
IGL02748:Mcm3ap APN 10 76501248 missense probably damaging 1.00
IGL02894:Mcm3ap APN 10 76477767 missense probably benign 0.00
IGL02903:Mcm3ap APN 10 76471258 splice site probably benign
IGL02955:Mcm3ap APN 10 76507466 missense probably benign 0.34
IGL02989:Mcm3ap APN 10 76471060 missense possibly damaging 0.48
IGL03003:Mcm3ap APN 10 76504697 missense probably benign 0.01
IGL03081:Mcm3ap APN 10 76470316 missense possibly damaging 0.86
IGL03218:Mcm3ap APN 10 76482733 missense probably damaging 1.00
IGL03401:Mcm3ap APN 10 76484649 splice site probably benign
doom UTSW 10 76501314 missense probably benign
psychopomp UTSW 10 76501100 missense probably damaging 0.97
woeful UTSW 10 76481015 missense probably benign 0.44
PIT4377001:Mcm3ap UTSW 10 76502762 missense possibly damaging 0.78
PIT4791001:Mcm3ap UTSW 10 76506473 missense probably damaging 1.00
R0105:Mcm3ap UTSW 10 76499534 missense probably damaging 1.00
R0144:Mcm3ap UTSW 10 76481015 missense probably benign 0.44
R0423:Mcm3ap UTSW 10 76502705 missense probably benign 0.00
R0692:Mcm3ap UTSW 10 76483169 missense probably damaging 1.00
R1402:Mcm3ap UTSW 10 76477914 unclassified probably benign
R1441:Mcm3ap UTSW 10 76471166 missense probably benign
R1512:Mcm3ap UTSW 10 76470513 missense probably damaging 1.00
R1533:Mcm3ap UTSW 10 76504287 missense probably damaging 1.00
R1569:Mcm3ap UTSW 10 76483188 missense possibly damaging 0.80
R1590:Mcm3ap UTSW 10 76496541 missense probably benign 0.36
R1597:Mcm3ap UTSW 10 76483226 missense probably damaging 1.00
R1743:Mcm3ap UTSW 10 76484674 missense possibly damaging 0.53
R1773:Mcm3ap UTSW 10 76471160 missense probably benign
R1922:Mcm3ap UTSW 10 76507361 missense probably damaging 1.00
R2061:Mcm3ap UTSW 10 76470068 missense probably benign 0.43
R2097:Mcm3ap UTSW 10 76512489 missense probably damaging 1.00
R2436:Mcm3ap UTSW 10 76490057 missense probably damaging 1.00
R3684:Mcm3ap UTSW 10 76489426 missense possibly damaging 0.64
R3690:Mcm3ap UTSW 10 76482679 missense probably damaging 1.00
R3881:Mcm3ap UTSW 10 76506446 missense probably benign 0.21
R4296:Mcm3ap UTSW 10 76507337 missense probably damaging 1.00
R4677:Mcm3ap UTSW 10 76470570 missense probably damaging 1.00
R4786:Mcm3ap UTSW 10 76488466 missense probably benign 0.00
R4882:Mcm3ap UTSW 10 76484661 nonsense probably null
R4907:Mcm3ap UTSW 10 76493441 missense probably damaging 1.00
R5108:Mcm3ap UTSW 10 76502702 missense probably benign 0.04
R5279:Mcm3ap UTSW 10 76507539 missense probably damaging 0.96
R5316:Mcm3ap UTSW 10 76470926 missense possibly damaging 0.89
R5402:Mcm3ap UTSW 10 76483314 missense probably benign 0.04
R5459:Mcm3ap UTSW 10 76496482 nonsense probably null
R5473:Mcm3ap UTSW 10 76502759 missense probably damaging 1.00
R5570:Mcm3ap UTSW 10 76481096 missense possibly damaging 0.89
R5939:Mcm3ap UTSW 10 76508361 missense probably benign 0.00
R5950:Mcm3ap UTSW 10 76488419 missense possibly damaging 0.46
R5998:Mcm3ap UTSW 10 76481142 critical splice donor site probably null
R6122:Mcm3ap UTSW 10 76506607 missense probably damaging 1.00
R6192:Mcm3ap UTSW 10 76501100 missense probably damaging 0.97
R6226:Mcm3ap UTSW 10 76515706 missense possibly damaging 0.95
R6293:Mcm3ap UTSW 10 76471478 nonsense probably null
R6669:Mcm3ap UTSW 10 76507337 missense probably damaging 0.98
R6715:Mcm3ap UTSW 10 76489532 missense possibly damaging 0.68
R6759:Mcm3ap UTSW 10 76501314 missense probably benign
R6864:Mcm3ap UTSW 10 76507479 missense probably damaging 1.00
R6870:Mcm3ap UTSW 10 76470215 missense probably benign 0.00
R6935:Mcm3ap UTSW 10 76504253 missense possibly damaging 0.84
R6947:Mcm3ap UTSW 10 76515666 missense probably benign 0.09
R7212:Mcm3ap UTSW 10 76501311 missense probably benign 0.01
R7403:Mcm3ap UTSW 10 76482823 critical splice donor site probably null
R7470:Mcm3ap UTSW 10 76508397 missense probably damaging 1.00
R7561:Mcm3ap UTSW 10 76492878 missense possibly damaging 0.94
X0026:Mcm3ap UTSW 10 76482785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGAGGACCAGGATCGCTC -3'
(R):5'- GTGGGACTTAAAATCAAGTGACC -3'

Sequencing Primer
(F):5'- GGCAGCAGAAGACCCTGATC -3'
(R):5'- CTTAAAATCAAGTGACCACAAGGG -3'
Posted On2017-02-28