Incidental Mutation 'R5931:Igha'
ID 461866
Institutional Source Beutler Lab
Gene Symbol Igha
Ensembl Gene ENSMUSG00000095079
Gene Name immunoglobulin heavy constant alpha
Synonyms IgA, Igh-2
MMRRC Submission 044126-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R5931 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 113219824-113223856 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 113223710 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 49 (T49S)
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000178282
AA Change: T49S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000194738
AA Change: T49S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have no detectable levels of IgA, decreased levels of IgG3, and increased levels of most other classes of immunoglobulins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A T 6: 91,896,096 (GRCm39) R315W probably damaging Het
Atrn A T 2: 130,775,356 (GRCm39) Y153F possibly damaging Het
C4b A G 17: 34,948,167 (GRCm39) V1644A probably damaging Het
Carmil3 A C 14: 55,736,397 (GRCm39) K654T probably damaging Het
Cdh1 T C 8: 107,392,964 (GRCm39) probably null Het
Chrna1 C T 2: 73,398,444 (GRCm39) V332M probably benign Het
Clca3a2 A C 3: 144,797,886 (GRCm39) V193G possibly damaging Het
Cyld A G 8: 89,456,470 (GRCm39) probably null Het
Dbt A T 3: 116,317,074 (GRCm39) E83D possibly damaging Het
Deup1 T C 9: 15,472,618 (GRCm39) R471G possibly damaging Het
Dgcr2 T A 16: 17,675,173 (GRCm39) I188F possibly damaging Het
Dgkg G A 16: 22,376,788 (GRCm39) R524* probably null Het
Dnaaf9 G A 2: 130,656,109 (GRCm39) T2M probably damaging Het
Dnah5 A T 15: 28,453,425 (GRCm39) R4399W probably damaging Het
Egflam G A 15: 7,273,338 (GRCm39) T579I possibly damaging Het
Eif2b2 C T 12: 85,269,561 (GRCm39) T211I probably damaging Het
Ep400 A G 5: 110,883,386 (GRCm39) probably benign Het
Ermp1 C G 19: 29,593,129 (GRCm39) A788P probably benign Het
Ern1 A G 11: 106,317,699 (GRCm39) S142P possibly damaging Het
Fbxo15 T A 18: 84,999,250 (GRCm39) C351S probably damaging Het
Fndc3a A T 14: 72,806,307 (GRCm39) S444T probably benign Het
Gabra6 G A 11: 42,198,268 (GRCm39) T384M probably benign Het
Gpbp1l1 T C 4: 116,447,457 (GRCm39) V379A probably benign Het
Hook2 G T 8: 85,722,375 (GRCm39) E305* probably null Het
Hoxa3 G A 6: 52,149,568 (GRCm39) A21V probably damaging Het
Hs1bp3 C A 12: 8,391,915 (GRCm39) P339Q probably benign Het
Klra4 C T 6: 130,030,016 (GRCm39) V190M possibly damaging Het
Lats2 A G 14: 57,933,588 (GRCm39) L843P probably damaging Het
Lcmt1 A G 7: 123,020,839 (GRCm39) T255A probably benign Het
Lpar6 A G 14: 73,476,368 (GRCm39) I110V probably damaging Het
Lrrtm4 A G 6: 79,998,722 (GRCm39) I44V probably damaging Het
Mcm3ap T C 10: 76,307,000 (GRCm39) V371A probably benign Het
Muc20 A T 16: 32,614,944 (GRCm39) D144E possibly damaging Het
Nphp3 T A 9: 103,897,945 (GRCm39) D417E probably damaging Het
Or7g33 A T 9: 19,448,629 (GRCm39) I199K probably benign Het
Or8b40 A G 9: 38,027,670 (GRCm39) I193V probably benign Het
Paqr7 A C 4: 134,235,031 (GRCm39) Y296S probably damaging Het
Pcdha4 A T 18: 37,087,808 (GRCm39) T664S probably damaging Het
Pelo T A 13: 115,225,379 (GRCm39) Y282F probably benign Het
Plxna2 A T 1: 194,493,178 (GRCm39) I1818F probably damaging Het
Pnkd A G 1: 74,389,833 (GRCm39) D319G probably benign Het
Pnma8a C A 7: 16,694,809 (GRCm39) N221K probably benign Het
Ppp1cb T A 5: 32,640,810 (GRCm39) probably null Het
Prkca T G 11: 107,905,136 (GRCm39) I201L probably benign Het
Prp2rt A G 13: 97,235,705 (GRCm39) L14S probably benign Het
Rfx2 G A 17: 57,087,778 (GRCm39) R538C probably damaging Het
Rph3a T C 5: 121,101,936 (GRCm39) Q100R probably damaging Het
Rtel1 C T 2: 180,972,608 (GRCm39) R29* probably null Het
Scel T A 14: 103,843,060 (GRCm39) Y547* probably null Het
Sp100 C T 1: 85,606,804 (GRCm39) P303L probably damaging Het
Stk31 A G 6: 49,446,236 (GRCm39) S958G probably benign Het
Syne2 T A 12: 76,055,639 (GRCm39) V4168E probably benign Het
Tenm3 A T 8: 49,099,533 (GRCm39) S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,285,493 (GRCm39) probably benign Het
Tmem248 T A 5: 130,258,349 (GRCm39) I14N probably damaging Het
Tor3a T C 1: 156,484,057 (GRCm39) I298V probably benign Het
Trim69 A T 2: 122,009,075 (GRCm39) K378N probably damaging Het
Ttc28 C T 5: 111,232,975 (GRCm39) P151S possibly damaging Het
Uaca T C 9: 60,779,294 (GRCm39) V1225A probably damaging Het
Vps4b T C 1: 106,705,065 (GRCm39) I343V probably benign Het
Wnk4 A G 11: 101,152,047 (GRCm39) T184A probably damaging Het
Ythdc2 T A 18: 45,006,023 (GRCm39) I1172K possibly damaging Het
Other mutations in Igha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03014:Igha UTSW 12 113,222,713 (GRCm39) missense unknown
R0078:Igha UTSW 12 113,223,547 (GRCm39) splice site probably benign
R3973:Igha UTSW 12 113,219,972 (GRCm39) unclassified probably benign
R4131:Igha UTSW 12 113,222,449 (GRCm39) critical splice donor site probably benign
R4866:Igha UTSW 12 113,223,129 (GRCm39) missense probably benign 0.30
R6101:Igha UTSW 12 113,220,017 (GRCm39) unclassified probably benign
R7735:Igha UTSW 12 113,220,019 (GRCm39) critical splice acceptor site probably benign
R8172:Igha UTSW 12 113,223,592 (GRCm39) missense
R8738:Igha UTSW 12 113,223,144 (GRCm39) missense probably damaging 1.00
R8951:Igha UTSW 12 113,222,684 (GRCm39) missense
R8985:Igha UTSW 12 113,222,611 (GRCm39) missense
R9803:Igha UTSW 12 113,222,759 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CCTAACGTTCTTTACCAGAGCAC -3'
(R):5'- TACTGGGCTAGGTTCTCCTG -3'

Sequencing Primer
(F):5'- AGAGCACTTCACATCCAATTCTTG -3'
(R):5'- GGCAGTGTGAAGACTACTATCTC -3'
Posted On 2017-02-28