Incidental Mutation 'R5931:Fndc3a'
ID461870
Institutional Source Beutler Lab
Gene Symbol Fndc3a
Ensembl Gene ENSMUSG00000033487
Gene Namefibronectin type III domain containing 3A
Synonyms1700094E19Rik, Fndc3, D14Ertd453e, F730017H24Rik, sys
MMRRC Submission 044126-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.529) question?
Stock #R5931 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location72537946-72710003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72568867 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 444 (S444T)
Ref Sequence ENSEMBL: ENSMUSP00000124637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089017] [ENSMUST00000162478]
Predicted Effect probably benign
Transcript: ENSMUST00000089017
AA Change: S444T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086411
Gene: ENSMUSG00000033487
AA Change: S444T

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
FN3 266 358 3.05e-6 SMART
FN3 371 452 3.42e-9 SMART
FN3 467 549 1.84e-9 SMART
FN3 564 647 1.06e-5 SMART
FN3 662 744 2.19e-7 SMART
FN3 759 838 5.48e-8 SMART
FN3 864 937 2.28e-5 SMART
FN3 951 1032 3.22e-5 SMART
FN3 1047 1127 5.63e0 SMART
transmembrane domain 1175 1197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159144
Predicted Effect probably benign
Transcript: ENSMUST00000162478
AA Change: S444T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124637
Gene: ENSMUSG00000033487
AA Change: S444T

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
FN3 266 358 3.05e-6 SMART
FN3 371 452 3.42e-9 SMART
Pfam:fn3 468 540 1.9e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162825
AA Change: S399T
SMART Domains Protein: ENSMUSP00000124218
Gene: ENSMUSG00000033487
AA Change: S399T

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 158 172 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
FN3 222 314 3.05e-6 SMART
FN3 327 408 3.42e-9 SMART
FN3 423 505 1.84e-9 SMART
FN3 520 603 1.06e-5 SMART
FN3 618 700 2.19e-7 SMART
FN3 715 794 5.48e-8 SMART
FN3 820 893 2.28e-5 SMART
FN3 907 988 3.22e-5 SMART
FN3 1003 1083 5.63e0 SMART
transmembrane domain 1131 1153 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Males homozygous for an insertional mutation are sterile; females are fertile. In mutant males, spermatids form multinucleated syncytia and fail to mature, while Sertoli cells exhibit abnormal cytoplasmic vacuoles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Clca2 A C 3: 145,092,125 V193G possibly damaging Het
Cyld A G 8: 88,729,842 probably null Het
Dbt A T 3: 116,523,425 E83D possibly damaging Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dgkg G A 16: 22,558,038 R524* probably null Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Eif2b2 C T 12: 85,222,787 T211I probably damaging Het
Ep400 A G 5: 110,735,520 probably benign Het
Ermp1 C G 19: 29,615,729 A788P probably benign Het
Ern1 A G 11: 106,426,873 S142P possibly damaging Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lpar6 A G 14: 73,238,928 I110V probably damaging Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tenm3 A T 8: 48,646,498 S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Trim69 A T 2: 122,178,594 K378N probably damaging Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Vps4b T C 1: 106,777,335 I343V probably benign Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Fndc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Fndc3a APN 14 72559357 splice site probably benign
IGL01120:Fndc3a APN 14 72556662 missense probably benign 0.05
IGL01577:Fndc3a APN 14 72589858 missense probably damaging 0.99
IGL01810:Fndc3a APN 14 72566141 missense probably benign 0.01
IGL01965:Fndc3a APN 14 72540402 missense probably benign 0.09
IGL01992:Fndc3a APN 14 72574556 missense probably benign 0.25
IGL02244:Fndc3a APN 14 72556367 splice site probably benign
IGL02639:Fndc3a APN 14 72574357 missense probably benign 0.08
IGL03076:Fndc3a APN 14 72556468 missense possibly damaging 0.82
IGL03096:Fndc3a APN 14 72599119 missense probably damaging 1.00
PIT4677001:Fndc3a UTSW 14 72574595 missense probably benign 0.02
R0112:Fndc3a UTSW 14 72540495 splice site probably benign
R0379:Fndc3a UTSW 14 72556609 missense probably damaging 1.00
R0381:Fndc3a UTSW 14 72556627 missense probably benign 0.05
R0544:Fndc3a UTSW 14 72557622 splice site probably benign
R1079:Fndc3a UTSW 14 72589807 missense possibly damaging 0.81
R1299:Fndc3a UTSW 14 72566198 splice site probably benign
R1424:Fndc3a UTSW 14 72574371 missense probably damaging 1.00
R1453:Fndc3a UTSW 14 72540328 nonsense probably null
R1478:Fndc3a UTSW 14 72557632 critical splice donor site probably null
R1573:Fndc3a UTSW 14 72568944 missense probably damaging 0.98
R1574:Fndc3a UTSW 14 72556557 missense probably damaging 1.00
R1574:Fndc3a UTSW 14 72556557 missense probably damaging 1.00
R1743:Fndc3a UTSW 14 72652081 missense probably damaging 1.00
R1852:Fndc3a UTSW 14 72556843 missense probably damaging 0.96
R2097:Fndc3a UTSW 14 72574351 critical splice donor site probably null
R2396:Fndc3a UTSW 14 72683683 missense possibly damaging 0.92
R2512:Fndc3a UTSW 14 72556275 missense probably benign 0.00
R3722:Fndc3a UTSW 14 72540208 missense probably benign 0.39
R5470:Fndc3a UTSW 14 72574568 missense possibly damaging 0.83
R5757:Fndc3a UTSW 14 72556585 missense probably benign
R6188:Fndc3a UTSW 14 72589961 missense probably damaging 0.99
R6297:Fndc3a UTSW 14 72563540 missense probably damaging 0.98
R6638:Fndc3a UTSW 14 72559248 nonsense probably null
R7221:Fndc3a UTSW 14 72556157 missense probably benign
R7571:Fndc3a UTSW 14 72589896 missense probably damaging 0.99
R7677:Fndc3a UTSW 14 72567414 missense probably benign
R7744:Fndc3a UTSW 14 72561716 missense possibly damaging 0.95
R7849:Fndc3a UTSW 14 72564660 missense probably benign 0.01
R8027:Fndc3a UTSW 14 72553543 missense probably benign 0.04
R8152:Fndc3a UTSW 14 72574380 missense probably damaging 1.00
R8225:Fndc3a UTSW 14 72557677 missense probably benign 0.00
R8295:Fndc3a UTSW 14 72552519 missense probably benign 0.03
Z1176:Fndc3a UTSW 14 72567373 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCCCTCTGGAGAGACATG -3'
(R):5'- TTCTGATACTGTATACTGTACCAGC -3'

Sequencing Primer
(F):5'- CCCTCTGGAGAGACATGTAAAG -3'
(R):5'- ACTGTATACTGTACCAGCTAGTAAAC -3'
Posted On2017-02-28