Incidental Mutation 'R5931:Lpar6'
ID461871
Institutional Source Beutler Lab
Gene Symbol Lpar6
Ensembl Gene ENSMUSG00000033446
Gene Namelysophosphatidic acid receptor 6
Synonyms2610302I02Rik, P2ry5, P2y5
MMRRC Submission 044126-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5931 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location73237895-73243294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73238928 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 110 (I110V)
Ref Sequence ENSEMBL: ENSMUSP00000042327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022701] [ENSMUST00000044405]
Predicted Effect probably benign
Transcript: ENSMUST00000022701
SMART Domains Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 37 53 N/A INTRINSIC
DUF3452 97 223 4.59e-25 SMART
RB_A 367 567 5.53e-92 SMART
CYCLIN 653 740 1.62e-5 SMART
Rb_C 761 920 1.28e-96 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000044405
AA Change: I110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042327
Gene: ENSMUSG00000033446
AA Change: I110V

DomainStartEndE-ValueType
Pfam:7tm_1 34 291 2.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170967
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of G-protein coupled receptors, that are preferentially activated by adenosine and uridine nucleotides. This gene aligns with an internal intron of the retinoblastoma susceptibility gene in the reverse orientation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Clca2 A C 3: 145,092,125 V193G possibly damaging Het
Cyld A G 8: 88,729,842 probably null Het
Dbt A T 3: 116,523,425 E83D possibly damaging Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dgkg G A 16: 22,558,038 R524* probably null Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Eif2b2 C T 12: 85,222,787 T211I probably damaging Het
Ep400 A G 5: 110,735,520 probably benign Het
Ermp1 C G 19: 29,615,729 A788P probably benign Het
Ern1 A G 11: 106,426,873 S142P possibly damaging Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Fndc3a A T 14: 72,568,867 S444T probably benign Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tenm3 A T 8: 48,646,498 S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Trim69 A T 2: 122,178,594 K378N probably damaging Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Vps4b T C 1: 106,777,335 I343V probably benign Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Lpar6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Lpar6 APN 14 73238637 missense probably damaging 1.00
IGL01611:Lpar6 APN 14 73239438 missense probably damaging 1.00
IGL01618:Lpar6 APN 14 73239066 missense probably damaging 0.96
IGL01676:Lpar6 APN 14 73239570 missense probably benign 0.24
IGL03031:Lpar6 APN 14 73239442 missense possibly damaging 0.64
IGL03061:Lpar6 APN 14 73239070 missense probably benign 0.03
runningback UTSW 14 73238707 missense probably damaging 1.00
R1900:Lpar6 UTSW 14 73239139 missense probably benign 0.01
R2895:Lpar6 UTSW 14 73239276 missense probably damaging 1.00
R2896:Lpar6 UTSW 14 73239276 missense probably damaging 1.00
R3972:Lpar6 UTSW 14 73239073 missense probably benign 0.01
R4305:Lpar6 UTSW 14 73238941 missense probably damaging 1.00
R4827:Lpar6 UTSW 14 73238750 missense probably damaging 1.00
R4989:Lpar6 UTSW 14 73238707 missense probably damaging 1.00
R5024:Lpar6 UTSW 14 73239369 missense probably damaging 0.99
R5133:Lpar6 UTSW 14 73238707 missense probably damaging 1.00
R5173:Lpar6 UTSW 14 73239097 missense probably benign 0.01
R6283:Lpar6 UTSW 14 73238857 missense probably damaging 1.00
R6316:Lpar6 UTSW 14 73239334 missense probably damaging 1.00
R7414:Lpar6 UTSW 14 73238800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTTCATCTGTGCCCTCAAAGTG -3'
(R):5'- CTGGAAAGTTCTCAAAGCAGGC -3'

Sequencing Primer
(F):5'- TGAGAAATGAAACTACAACGTACATG -3'
(R):5'- TCTCAAAGCAGGCTTCTGAG -3'
Posted On2017-02-28