Incidental Mutation 'R5931:Dgkg'
ID461876
Institutional Source Beutler Lab
Gene Symbol Dgkg
Ensembl Gene ENSMUSG00000022861
Gene Namediacylglycerol kinase, gamma
SynonymsE430001K23Rik, 2900055E17Rik, Dagk3
MMRRC Submission 044126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R5931 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22468461-22657221 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 22558038 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 524 (R524*)
Ref Sequence ENSEMBL: ENSMUSP00000087371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023578] [ENSMUST00000089925] [ENSMUST00000137311]
Predicted Effect probably null
Transcript: ENSMUST00000023578
AA Change: R485*
SMART Domains Protein: ENSMUSP00000023578
Gene: ENSMUSG00000022861
AA Change: R485*

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 2 172 9.3e-66 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
DAGKc 392 516 5.29e-65 SMART
DAGKa 536 710 1.25e-116 SMART
low complexity region 735 748 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000089925
AA Change: R524*
SMART Domains Protein: ENSMUSP00000087371
Gene: ENSMUSG00000022861
AA Change: R524*

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 5 172 3.9e-54 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
C1 334 380 3.35e-3 SMART
DAGKc 431 555 5.29e-65 SMART
DAGKa 575 749 1.25e-116 SMART
low complexity region 774 787 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137311
SMART Domains Protein: ENSMUSP00000114441
Gene: ENSMUSG00000022861

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 2 172 3.8e-67 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the type I subfamily of diacylglycerol kinases, which are involved in lipid metabolism. These enzymes generate phosphatidic acid by catalyzing the phosphorylation of diacylglycerol, a fundamental lipid second messenger that activates numerous proteins, including protein kinase C isoforms, Ras guanyl nucleotide-releasing proteins and some transient receptor potential channels. Diacylglycerol kinase gamma has been implicated in cell cycle regulation and in the negative regulation of macrophage differentiation in leukemia cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Clca2 A C 3: 145,092,125 V193G possibly damaging Het
Cyld A G 8: 88,729,842 probably null Het
Dbt A T 3: 116,523,425 E83D possibly damaging Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Eif2b2 C T 12: 85,222,787 T211I probably damaging Het
Ep400 A G 5: 110,735,520 probably benign Het
Ermp1 C G 19: 29,615,729 A788P probably benign Het
Ern1 A G 11: 106,426,873 S142P possibly damaging Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Fndc3a A T 14: 72,568,867 S444T probably benign Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lpar6 A G 14: 73,238,928 I110V probably damaging Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tenm3 A T 8: 48,646,498 S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Trim69 A T 2: 122,178,594 K378N probably damaging Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Vps4b T C 1: 106,777,335 I343V probably benign Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Dgkg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Dgkg APN 16 22479362 splice site probably benign
IGL01347:Dgkg APN 16 22600590 missense probably benign 0.13
IGL02313:Dgkg APN 16 22570230 splice site probably benign
IGL02498:Dgkg APN 16 22548691 missense probably damaging 1.00
IGL02954:Dgkg APN 16 22622253 missense probably benign 0.00
IGL03103:Dgkg APN 16 22580525 missense probably damaging 1.00
R0014:Dgkg UTSW 16 22565364 splice site probably null
R0636:Dgkg UTSW 16 22579729 splice site probably benign
R0666:Dgkg UTSW 16 22562730 missense probably damaging 1.00
R1056:Dgkg UTSW 16 22600541 missense probably damaging 1.00
R1495:Dgkg UTSW 16 22500379 missense probably damaging 1.00
R1603:Dgkg UTSW 16 22570159 splice site probably benign
R1993:Dgkg UTSW 16 22600594 missense probably damaging 1.00
R2073:Dgkg UTSW 16 22565317 missense probably damaging 0.96
R2192:Dgkg UTSW 16 22588299 missense probably damaging 0.98
R2251:Dgkg UTSW 16 22622260 start codon destroyed probably null 0.98
R2252:Dgkg UTSW 16 22622260 start codon destroyed probably null 0.98
R3104:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R3105:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R3106:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R4804:Dgkg UTSW 16 22575193 intron probably benign
R5272:Dgkg UTSW 16 22588294 splice site probably null
R5364:Dgkg UTSW 16 22600461 missense probably benign 0.03
R5417:Dgkg UTSW 16 22588331 missense possibly damaging 0.50
R5677:Dgkg UTSW 16 22570171 missense probably benign 0.00
R5839:Dgkg UTSW 16 22566494 missense possibly damaging 0.91
R6313:Dgkg UTSW 16 22519561 missense probably damaging 0.96
R7017:Dgkg UTSW 16 22572713 missense probably benign 0.31
R7135:Dgkg UTSW 16 22500382 missense probably damaging 1.00
R7326:Dgkg UTSW 16 22548690 missense probably damaging 1.00
R7476:Dgkg UTSW 16 22622304 start gained probably benign
Z1088:Dgkg UTSW 16 22469328 missense probably damaging 0.96
Z1088:Dgkg UTSW 16 22572686 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GGAGGAATTTTACGCAGAAACTTC -3'
(R):5'- TCTGCAAAGGGTGTGTTCTCC -3'

Sequencing Primer
(F):5'- TCGGAATGCACATCAGGA -3'
(R):5'- CAAAGGGTGTGTTCTCCATCACAG -3'
Posted On2017-02-28