Incidental Mutation 'R0566:Prr23a2'
ID46190
Institutional Source Beutler Lab
Gene Symbol Prr23a2
Ensembl Gene ENSMUSG00000063058
Gene Nameproline rich 23A, member 2
SynonymsGm6406
MMRRC Submission 038757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R0566 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location98856494-98857374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98856988 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 133 (L133H)
Ref Sequence ENSEMBL: ENSMUSP00000071270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071302]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071302
AA Change: L133H

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071270
Gene: ENSMUSG00000063058
AA Change: L133H

DomainStartEndE-ValueType
Pfam:DUF2476 2 250 1.5e-92 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 96% (24/25)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 122,781,527 L254P possibly damaging Het
Adamts6 C A 13: 104,444,927 A850E probably benign Het
Ccdc112 A C 18: 46,290,810 V287G probably damaging Het
Ctbp2 A G 7: 132,991,147 V811A probably damaging Het
Dchs1 A G 7: 105,759,195 V1810A probably benign Het
Dhx15 T G 5: 52,171,425 K287T probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fryl T C 5: 73,064,497 probably benign Het
Gnpda2 A G 5: 69,584,961 probably benign Het
Mto1 T C 9: 78,448,301 F2S possibly damaging Het
Nlrp1a A G 11: 71,122,942 L494P probably benign Het
Olfr456 T A 6: 42,487,091 Y34F probably damaging Het
Paqr8 C A 1: 20,935,463 H280Q possibly damaging Het
Perm1 A T 4: 156,217,859 M287L probably benign Het
Piwil2 A G 14: 70,410,394 V323A probably damaging Het
Pon3 A G 6: 5,232,408 V131A possibly damaging Het
Prima1 C A 12: 103,197,314 A133S probably benign Het
Prl7c1 A G 13: 27,778,978 L14P probably damaging Het
Samd3 T C 10: 26,244,498 V157A possibly damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tep1 A T 14: 50,845,414 probably null Het
Tmem208 T C 8: 105,334,843 V167A probably benign Het
Tnrc6a A T 7: 123,170,913 N642I probably benign Het
Vps26a A G 10: 62,480,546 probably benign Het
Zfp112 T C 7: 24,125,677 S357P probably benign Het
Other mutations in Prr23a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Prr23a2 APN 9 98856961 missense probably benign 0.03
IGL01867:Prr23a2 APN 9 98857060 missense probably benign
R0542:Prr23a2 UTSW 9 98857033 missense probably benign 0.00
R0831:Prr23a2 UTSW 9 98856864 missense probably damaging 1.00
R5382:Prr23a2 UTSW 9 98857176 missense probably damaging 1.00
R7309:Prr23a2 UTSW 9 98856974 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GGAGCCTAGTGTGACATTTCACGAC -3'
(R):5'- CCTGGGACTTGTTCCTGCAACAAAG -3'

Sequencing Primer
(F):5'- AGAGCCGTCCATCATGCTG -3'
(R):5'- CTTGTTCCTGCAACAAAGGACTG -3'
Posted On2013-06-11