Incidental Mutation 'R5932:Trim24'
ID461922
Institutional Source Beutler Lab
Gene Symbol Trim24
Ensembl Gene ENSMUSG00000029833
Gene Nametripartite motif-containing 24
SynonymsA130082H20Rik, D430004I05Rik, TIF1alpha, Tif1a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5932 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location37870811-37966296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37957075 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 651 (I651T)
Ref Sequence ENSEMBL: ENSMUSP00000114001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031859] [ENSMUST00000120238] [ENSMUST00000120428]
Predicted Effect probably damaging
Transcript: ENSMUST00000031859
AA Change: I721T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031859
Gene: ENSMUSG00000029833
AA Change: I721T

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 2.5e-10 SMART
BBOX 158 205 2e-13 SMART
BBOX 218 259 7e-14 SMART
BBC 266 392 3e-44 SMART
low complexity region 474 491 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
low complexity region 573 598 N/A INTRINSIC
low complexity region 686 709 N/A INTRINSIC
low complexity region 759 774 N/A INTRINSIC
PHD 829 872 2.1e-13 SMART
BROMO 902 1007 2.4e-40 SMART
low complexity region 1025 1033 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120238
AA Change: I651T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114001
Gene: ENSMUSG00000029833
AA Change: I651T

DomainStartEndE-ValueType
BBOX 88 135 2e-13 SMART
BBOX 148 189 6.8e-14 SMART
BBC 196 322 3e-44 SMART
low complexity region 404 421 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
low complexity region 503 528 N/A INTRINSIC
low complexity region 616 639 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
PHD 759 802 2e-13 SMART
BROMO 832 937 2.4e-40 SMART
low complexity region 955 963 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120428
AA Change: I687T

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113063
Gene: ENSMUSG00000029833
AA Change: I687T

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 5.22e-8 SMART
BBOX 158 205 6.27e-11 SMART
BBOX 218 259 2.22e-11 SMART
BBC 266 392 5.86e-42 SMART
low complexity region 539 564 N/A INTRINSIC
low complexity region 652 675 N/A INTRINSIC
low complexity region 725 740 N/A INTRINSIC
PHD 795 838 3.15e-11 SMART
BROMO 868 973 3.95e-38 SMART
low complexity region 991 999 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135387
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which are typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. This protein, which also contains a PHD/TTC finger and bromodomain important for regulating nuclear receptors and binding chromatin, has important roles in differentiation, development, and tissue homeostasis. This protein has been reported to regulate the activity of the tumor suppressor p53 and of the retinoic acid receptor. A translocation event between this gene and Braf transforming gene, which results in the fusion protein T18, has been reported in hepatocellular carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased hepatocyte ploidy and uncontrolled hepatocellular proliferation; most adult mice develop malignant hepatocellular carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,244,595 probably null Het
A1cf T A 19: 31,893,118 S7T possibly damaging Het
A530099J19Rik C A 13: 19,729,476 noncoding transcript Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Akap1 A G 11: 88,831,759 L890P probably damaging Het
Akap13 T A 7: 75,610,184 M49K probably damaging Het
Ankrd17 A T 5: 90,265,436 N1206K probably damaging Het
Bbs7 G A 3: 36,582,698 T480I probably benign Het
Bbs9 A G 9: 22,812,331 E769G probably damaging Het
BC027072 T C 17: 71,751,753 R310G probably damaging Het
Bpgm T A 6: 34,487,925 S192R probably damaging Het
Brinp1 C A 4: 68,792,941 K343N probably benign Het
Cabyr T G 18: 12,754,350 V185G probably damaging Het
Cadm1 C A 9: 47,799,451 D217E probably damaging Het
Camk1g T A 1: 193,354,039 E171V probably benign Het
Casz1 T A 4: 148,939,113 M825K possibly damaging Het
Ccdc27 A G 4: 154,026,774 V627A probably benign Het
Ccdc40 T G 11: 119,251,012 I808R probably damaging Het
Cdh23 G A 10: 60,392,984 R1140C probably damaging Het
Celsr1 A G 15: 86,032,704 V356A probably damaging Het
Cep126 T A 9: 8,103,508 D167V probably damaging Het
Chmp4b C T 2: 154,691,281 T147I probably benign Het
Clstn3 A T 6: 124,438,332 M728K probably benign Het
Col7a1 A T 9: 108,980,211 E2618V unknown Het
Crls1 T A 2: 132,864,167 Y170* probably null Het
Epas1 T G 17: 86,827,646 I569S possibly damaging Het
Fhl3 T C 4: 124,705,727 Y32H probably damaging Het
Fibp G A 19: 5,464,425 G333D probably benign Het
Frmd4a C T 2: 4,529,839 T156I probably damaging Het
Gcn1l1 T C 5: 115,592,376 L873P possibly damaging Het
Hectd3 G A 4: 117,002,273 R698H possibly damaging Het
Il17a T C 1: 20,733,753 V124A probably damaging Het
Kif14 A T 1: 136,516,390 E1373D probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Kmt2a T C 9: 44,820,647 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Lamb2 T C 9: 108,480,611 I111T probably damaging Het
Lrch3 A T 16: 32,975,736 D204V probably damaging Het
Mansc1 C A 6: 134,610,515 R233L possibly damaging Het
Mkrn3 A G 7: 62,418,907 C379R probably damaging Het
Ncoa3 T A 2: 166,070,125 probably null Het
Neu3 A T 7: 99,813,318 C399* probably null Het
Olfr287 T G 15: 98,207,415 *323S probably null Het
Olfr671 G A 7: 104,975,655 T114M probably damaging Het
Pde5a T C 3: 122,841,044 F713L probably benign Het
Pdk1 T A 2: 71,883,416 probably null Het
Plin4 A G 17: 56,106,356 V423A possibly damaging Het
Pstpip1 T A 9: 56,125,930 Y249N probably damaging Het
Ptprf A T 4: 118,211,767 C1673S probably benign Het
Pum1 A G 4: 130,730,366 T230A probably benign Het
Qsox1 A T 1: 155,789,333 D287E probably benign Het
Rad51ap2 A G 12: 11,458,386 N770D probably damaging Het
Rtp3 T A 9: 110,986,692 I202F probably benign Het
Slc26a4 C T 12: 31,535,249 probably null Het
Spata48 A G 11: 11,488,513 probably benign Het
Sptbn1 C G 11: 30,136,136 V1191L probably damaging Het
St5 G A 7: 109,570,016 T24M probably damaging Het
Tead2 T C 7: 45,232,899 Y121H probably benign Het
Thsd7b T C 1: 129,430,838 L3P probably benign Het
Usp2 A G 9: 44,092,333 I481V probably benign Het
Vps13d C A 4: 145,045,041 V4056F possibly damaging Het
Yeats2 A G 16: 20,193,163 E496G probably benign Het
Zap70 A G 1: 36,781,146 K503E probably damaging Het
Zbtb46 A G 2: 181,411,920 L333P probably benign Het
Zfc3h1 A T 10: 115,400,910 T430S probably benign Het
Zfp618 C T 4: 63,118,566 R368* probably null Het
Other mutations in Trim24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Trim24 APN 6 37903648 missense possibly damaging 0.76
IGL01307:Trim24 APN 6 37965635 missense possibly damaging 0.81
IGL01790:Trim24 APN 6 37945613 missense probably benign
IGL02525:Trim24 APN 6 37945718 missense probably damaging 0.99
IGL02557:Trim24 APN 6 37965499 critical splice acceptor site probably null
IGL02671:Trim24 APN 6 37960784 missense probably damaging 1.00
IGL02795:Trim24 APN 6 37919389 missense probably damaging 1.00
IGL02877:Trim24 APN 6 37965646 missense probably damaging 1.00
IGL02889:Trim24 APN 6 37957761 missense probably benign 0.02
IGL02930:Trim24 APN 6 37951445 splice site probably benign
IGL03076:Trim24 APN 6 37965632 missense probably damaging 0.98
Lithe UTSW 6 37958569 missense probably damaging 1.00
Nervous UTSW 6 37957729 missense probably damaging 1.00
pliant UTSW 6 37919491 critical splice donor site probably null
qualmish UTSW 6 37903652 critical splice donor site probably null
Queasy UTSW 6 37908305 missense probably damaging 0.99
squeamish UTSW 6 37915202 nonsense probably null
Uneasy UTSW 6 37956477 critical splice donor site probably null
PIT4651001:Trim24 UTSW 6 37900732 critical splice donor site probably null
R0037:Trim24 UTSW 6 37957549 missense probably damaging 1.00
R0037:Trim24 UTSW 6 37957549 missense probably damaging 1.00
R0183:Trim24 UTSW 6 37943480 missense possibly damaging 0.90
R0471:Trim24 UTSW 6 37915195 missense possibly damaging 0.94
R0485:Trim24 UTSW 6 37957066 missense probably damaging 1.00
R0606:Trim24 UTSW 6 37871234 missense probably benign
R0609:Trim24 UTSW 6 37957783 missense probably damaging 1.00
R0637:Trim24 UTSW 6 37958559 splice site probably null
R0734:Trim24 UTSW 6 37919465 missense possibly damaging 0.86
R0855:Trim24 UTSW 6 37915202 nonsense probably null
R1131:Trim24 UTSW 6 37957782 missense probably damaging 1.00
R1141:Trim24 UTSW 6 37915293 missense probably damaging 1.00
R1159:Trim24 UTSW 6 37956477 critical splice donor site probably null
R1460:Trim24 UTSW 6 37964826 missense probably damaging 1.00
R1672:Trim24 UTSW 6 37915279 missense probably damaging 1.00
R1868:Trim24 UTSW 6 37951512 missense probably damaging 0.99
R1888:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1888:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1894:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1913:Trim24 UTSW 6 37957815 missense probably damaging 1.00
R2254:Trim24 UTSW 6 37958677 missense probably benign
R2511:Trim24 UTSW 6 37903652 critical splice donor site probably null
R2849:Trim24 UTSW 6 37956453 missense probably damaging 0.99
R3878:Trim24 UTSW 6 37964773 missense probably benign 0.14
R4084:Trim24 UTSW 6 37915257 missense probably damaging 1.00
R4235:Trim24 UTSW 6 37964740 missense probably damaging 1.00
R4292:Trim24 UTSW 6 37900692 missense possibly damaging 0.91
R4633:Trim24 UTSW 6 37956436 missense probably damaging 0.98
R4651:Trim24 UTSW 6 37957839 critical splice donor site probably null
R4652:Trim24 UTSW 6 37957839 critical splice donor site probably null
R4686:Trim24 UTSW 6 37908305 missense probably damaging 0.99
R5000:Trim24 UTSW 6 37958612 missense probably benign 0.01
R5213:Trim24 UTSW 6 37957075 missense probably damaging 0.99
R5258:Trim24 UTSW 6 37919400 missense probably damaging 0.99
R5292:Trim24 UTSW 6 37903604 missense probably benign 0.23
R5395:Trim24 UTSW 6 37957744 missense probably damaging 1.00
R5547:Trim24 UTSW 6 37965550 missense probably damaging 1.00
R5666:Trim24 UTSW 6 37965601 missense probably benign 0.19
R5670:Trim24 UTSW 6 37965601 missense probably benign 0.19
R5849:Trim24 UTSW 6 37957729 missense probably damaging 1.00
R5927:Trim24 UTSW 6 37958569 missense probably damaging 1.00
R6286:Trim24 UTSW 6 37919491 critical splice donor site probably null
R6374:Trim24 UTSW 6 37953549 missense probably benign 0.12
R6449:Trim24 UTSW 6 37903652 critical splice donor site probably null
R6723:Trim24 UTSW 6 37951468 missense probably benign 0.00
R6731:Trim24 UTSW 6 37943485 missense probably damaging 0.99
R6975:Trim24 UTSW 6 37919492 critical splice donor site probably null
R7000:Trim24 UTSW 6 37958678 missense probably benign 0.24
R7067:Trim24 UTSW 6 37957840 splice site probably null
R7126:Trim24 UTSW 6 37919457 missense probably damaging 1.00
R7162:Trim24 UTSW 6 37965521 missense possibly damaging 0.68
R7486:Trim24 UTSW 6 37957839 critical splice donor site probably null
R7779:Trim24 UTSW 6 37919397 missense probably damaging 1.00
R7779:Trim24 UTSW 6 37919398 missense probably damaging 0.99
R8070:Trim24 UTSW 6 37957726 missense probably damaging 0.99
RF007:Trim24 UTSW 6 37953536 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CGTTACTATTGTGAAGTGGCAG -3'
(R):5'- GCAGTGTGGAAGTCAATGC -3'

Sequencing Primer
(F):5'- GGCAGTATTCCAGAATGTTCTTCAG -3'
(R):5'- TTGACACAATCTGGAGCCATG -3'
Posted On2017-02-28