Incidental Mutation 'R5932:Bbs9'
ID461933
Institutional Source Beutler Lab
Gene Symbol Bbs9
Ensembl Gene ENSMUSG00000035919
Gene NameBardet-Biedl syndrome 9 (human)
SynonymsE130103I17Rik, EST 3159894
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R5932 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location22475715-22888280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22812331 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 769 (E769G)
Ref Sequence ENSEMBL: ENSMUSP00000120927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039798] [ENSMUST00000127296] [ENSMUST00000147405] [ENSMUST00000147712] [ENSMUST00000150395]
Predicted Effect probably damaging
Transcript: ENSMUST00000039798
AA Change: E764G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043042
Gene: ENSMUSG00000035919
AA Change: E764G

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124076
Predicted Effect probably benign
Transcript: ENSMUST00000127296
Predicted Effect probably benign
Transcript: ENSMUST00000136084
SMART Domains Protein: ENSMUSP00000123160
Gene: ENSMUSG00000035919

DomainStartEndE-ValueType
Pfam:PHTB1_C 24 162 2.9e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147405
AA Change: E769G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120927
Gene: ENSMUSG00000035919
AA Change: E769G

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 417 1.1e-166 PFAM
Pfam:PHTB1_C 440 818 7e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147712
AA Change: E764G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122058
Gene: ENSMUSG00000035919
AA Change: E764G

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150395
AA Change: E764G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116629
Gene: ENSMUSG00000035919
AA Change: E764G

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is downregulated by parathyroid hormone in osteoblastic cells, and therefore is thought to be involved in parathyroid hormone action in bones. The exact function of this gene has not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,244,595 probably null Het
A1cf T A 19: 31,893,118 S7T possibly damaging Het
A530099J19Rik C A 13: 19,729,476 noncoding transcript Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Akap1 A G 11: 88,831,759 L890P probably damaging Het
Akap13 T A 7: 75,610,184 M49K probably damaging Het
Ankrd17 A T 5: 90,265,436 N1206K probably damaging Het
Bbs7 G A 3: 36,582,698 T480I probably benign Het
BC027072 T C 17: 71,751,753 R310G probably damaging Het
Bpgm T A 6: 34,487,925 S192R probably damaging Het
Brinp1 C A 4: 68,792,941 K343N probably benign Het
Cabyr T G 18: 12,754,350 V185G probably damaging Het
Cadm1 C A 9: 47,799,451 D217E probably damaging Het
Camk1g T A 1: 193,354,039 E171V probably benign Het
Casz1 T A 4: 148,939,113 M825K possibly damaging Het
Ccdc27 A G 4: 154,026,774 V627A probably benign Het
Ccdc40 T G 11: 119,251,012 I808R probably damaging Het
Cdh23 G A 10: 60,392,984 R1140C probably damaging Het
Celsr1 A G 15: 86,032,704 V356A probably damaging Het
Cep126 T A 9: 8,103,508 D167V probably damaging Het
Chmp4b C T 2: 154,691,281 T147I probably benign Het
Clstn3 A T 6: 124,438,332 M728K probably benign Het
Col7a1 A T 9: 108,980,211 E2618V unknown Het
Crls1 T A 2: 132,864,167 Y170* probably null Het
Epas1 T G 17: 86,827,646 I569S possibly damaging Het
Fhl3 T C 4: 124,705,727 Y32H probably damaging Het
Fibp G A 19: 5,464,425 G333D probably benign Het
Frmd4a C T 2: 4,529,839 T156I probably damaging Het
Gcn1l1 T C 5: 115,592,376 L873P possibly damaging Het
Hectd3 G A 4: 117,002,273 R698H possibly damaging Het
Il17a T C 1: 20,733,753 V124A probably damaging Het
Kif14 A T 1: 136,516,390 E1373D probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Kmt2a T C 9: 44,820,647 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Lamb2 T C 9: 108,480,611 I111T probably damaging Het
Lrch3 A T 16: 32,975,736 D204V probably damaging Het
Mansc1 C A 6: 134,610,515 R233L possibly damaging Het
Mkrn3 A G 7: 62,418,907 C379R probably damaging Het
Ncoa3 T A 2: 166,070,125 probably null Het
Neu3 A T 7: 99,813,318 C399* probably null Het
Olfr287 T G 15: 98,207,415 *323S probably null Het
Olfr671 G A 7: 104,975,655 T114M probably damaging Het
Pde5a T C 3: 122,841,044 F713L probably benign Het
Pdk1 T A 2: 71,883,416 probably null Het
Plin4 A G 17: 56,106,356 V423A possibly damaging Het
Pstpip1 T A 9: 56,125,930 Y249N probably damaging Het
Ptprf A T 4: 118,211,767 C1673S probably benign Het
Pum1 A G 4: 130,730,366 T230A probably benign Het
Qsox1 A T 1: 155,789,333 D287E probably benign Het
Rad51ap2 A G 12: 11,458,386 N770D probably damaging Het
Rtp3 T A 9: 110,986,692 I202F probably benign Het
Slc26a4 C T 12: 31,535,249 probably null Het
Spata48 A G 11: 11,488,513 probably benign Het
Sptbn1 C G 11: 30,136,136 V1191L probably damaging Het
St5 G A 7: 109,570,016 T24M probably damaging Het
Tead2 T C 7: 45,232,899 Y121H probably benign Het
Thsd7b T C 1: 129,430,838 L3P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Usp2 A G 9: 44,092,333 I481V probably benign Het
Vps13d C A 4: 145,045,041 V4056F possibly damaging Het
Yeats2 A G 16: 20,193,163 E496G probably benign Het
Zap70 A G 1: 36,781,146 K503E probably damaging Het
Zbtb46 A G 2: 181,411,920 L333P probably benign Het
Zfc3h1 A T 10: 115,400,910 T430S probably benign Het
Zfp618 C T 4: 63,118,566 R368* probably null Het
Other mutations in Bbs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Bbs9 APN 9 22887683 missense probably benign 0.00
IGL01586:Bbs9 APN 9 22645997 missense possibly damaging 0.46
IGL01646:Bbs9 APN 9 22670925 nonsense probably null
IGL01654:Bbs9 APN 9 22490942 critical splice donor site probably null
IGL02172:Bbs9 APN 9 22579476 missense possibly damaging 0.65
IGL02212:Bbs9 APN 9 22812512 missense probably benign 0.02
IGL02444:Bbs9 APN 9 22643787 missense probably damaging 0.96
IGL02829:Bbs9 APN 9 22579484 missense probably damaging 0.98
IGL03385:Bbs9 APN 9 22643748 missense probably benign 0.19
corpulent UTSW 9 22575196 critical splice donor site probably null
Crapulence UTSW 9 22567764 missense probably damaging 1.00
R0038:Bbs9 UTSW 9 22504094 missense probably benign 0.30
R0243:Bbs9 UTSW 9 22514001 missense probably damaging 1.00
R0595:Bbs9 UTSW 9 22496815 missense probably benign
R0688:Bbs9 UTSW 9 22567719 missense probably damaging 0.98
R0726:Bbs9 UTSW 9 22793823 missense probably damaging 0.99
R0749:Bbs9 UTSW 9 22575201 splice site probably null
R0783:Bbs9 UTSW 9 22567714 missense possibly damaging 0.69
R1148:Bbs9 UTSW 9 22575100 splice site probably benign
R1532:Bbs9 UTSW 9 22887649 missense probably benign 0.00
R1783:Bbs9 UTSW 9 22659119 missense possibly damaging 0.85
R2285:Bbs9 UTSW 9 22678934 missense probably damaging 1.00
R2402:Bbs9 UTSW 9 22646063 missense probably benign 0.23
R2655:Bbs9 UTSW 9 22504052 missense probably damaging 1.00
R3428:Bbs9 UTSW 9 22567887 splice site probably benign
R3798:Bbs9 UTSW 9 22638769 missense probably damaging 1.00
R3806:Bbs9 UTSW 9 22887630 missense probably damaging 0.98
R4660:Bbs9 UTSW 9 22578767 missense probably benign 0.16
R4873:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R4875:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R5291:Bbs9 UTSW 9 22628997 missense probably damaging 1.00
R5364:Bbs9 UTSW 9 22575196 critical splice donor site probably null
R5502:Bbs9 UTSW 9 22504074 missense probably damaging 1.00
R5646:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R6222:Bbs9 UTSW 9 22567851 missense possibly damaging 0.88
R6451:Bbs9 UTSW 9 22567764 missense probably damaging 1.00
R6547:Bbs9 UTSW 9 22514069 missense probably benign 0.01
R6726:Bbs9 UTSW 9 22645964 missense probably benign 0.00
R6745:Bbs9 UTSW 9 22670836 missense probably benign 0.00
R6908:Bbs9 UTSW 9 22567723 missense probably damaging 0.96
R6919:Bbs9 UTSW 9 22812544 critical splice donor site probably null
R7102:Bbs9 UTSW 9 22579553 missense probably damaging 1.00
R7536:Bbs9 UTSW 9 22670800 missense probably damaging 1.00
R7712:Bbs9 UTSW 9 22670813 missense probably benign 0.34
X0027:Bbs9 UTSW 9 22655330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACAGGACAAAGCACTTC -3'
(R):5'- AGGAATCTTACCTGGCACAACC -3'

Sequencing Primer
(F):5'- GGACAAAGCACTTCCCACATGTG -3'
(R):5'- TGGCACAACCATGGCCTG -3'
Posted On2017-02-28