Incidental Mutation 'R5933:Dnah7c'
ID 461970
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
MMRRC Submission 044127-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R5933 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 46425592-46807476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46519215 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 494 (Y494H)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000189749
AA Change: Y494H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: Y494H

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Meta Mutation Damage Score 0.2614 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 94% (99/105)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,070,348 P1766L probably damaging Het
Abca13 A G 11: 9,249,658 Q119R possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aipl1 A C 11: 72,030,282 C237G probably benign Het
Ankdd1a C T 9: 65,509,696 A154T probably benign Het
Arglu1 T C 8: 8,690,047 S91G probably benign Het
Arhgef33 C A 17: 80,337,280 H13N probably benign Het
Atp1a4 A G 1: 172,232,274 I796T possibly damaging Het
Birc6 C G 17: 74,599,237 S1374R probably damaging Het
Birc6 T A 17: 74,599,238 S72T probably damaging Het
Bmpr1b T C 3: 141,871,367 *59W probably null Het
Btbd16 A T 7: 130,784,281 Q63L probably damaging Het
Cacna1c C T 6: 118,612,580 R1592H probably damaging Het
Caps2 G A 10: 112,215,446 E541K probably benign Het
Card9 T C 2: 26,352,497 E500G probably damaging Het
Carnmt1 T C 19: 18,704,105 V396A probably benign Het
Ccnl1 T A 3: 65,948,342 K320M probably damaging Het
Cdh20 A C 1: 104,984,671 D550A probably damaging Het
Cdhr1 T A 14: 37,089,462 T231S probably benign Het
Cenpe T C 3: 135,261,628 V2177A probably benign Het
Cfap69 A G 5: 5,640,183 C161R probably damaging Het
Ctsd C T 7: 142,376,579 V403I probably benign Het
Cyth1 C T 11: 118,185,759 probably null Het
Dazl A T 17: 50,287,753 probably null Het
Disp3 A T 4: 148,241,313 C1329* probably null Het
Dld C T 12: 31,333,983 V374I probably benign Het
Dnttip2 T A 3: 122,275,568 M144K probably benign Het
Drc1 A T 5: 30,345,529 D132V probably damaging Het
Enpp6 A G 8: 47,066,004 D269G probably benign Het
Ephx4 T A 5: 107,403,765 probably null Het
Evl T C 12: 108,683,257 S345P possibly damaging Het
Fam193a A T 5: 34,465,680 D1204V probably damaging Het
Fat2 A T 11: 55,284,051 D1945E probably damaging Het
Fat4 T C 3: 38,951,375 probably null Het
Fbln7 A T 2: 128,877,498 M72L probably benign Het
Flnc T C 6: 29,441,106 V353A probably damaging Het
Fry T C 5: 150,390,800 probably benign Het
Galnt14 A T 17: 73,526,305 C225S probably benign Het
Gapvd1 T C 2: 34,684,291 S1265G probably benign Het
Gm13030 A G 4: 138,871,204 F136S unknown Het
Gucy1a1 T C 3: 82,094,807 H655R probably damaging Het
Hk1 A G 10: 62,269,994 L890P probably damaging Het
Igfn1 T A 1: 135,970,603 R742* probably null Het
Igkv12-49 T C 6: 69,716,569 noncoding transcript Het
Igkv2-109 T A 6: 68,302,981 L62Q possibly damaging Het
Itgb3 A G 11: 104,637,979 T311A possibly damaging Het
Kl A G 5: 150,989,483 E899G probably damaging Het
Kyat3 A T 3: 142,723,260 D151V probably damaging Het
Morc2b A T 17: 33,138,609 M63K possibly damaging Het
Mtbp T A 15: 55,571,327 F298L possibly damaging Het
Mtmr3 C T 11: 4,498,951 V272I probably benign Het
Muc4 A G 16: 32,753,052 T977A probably benign Het
Nebl G A 2: 17,404,187 H367Y probably benign Het
Nop58 T A 1: 59,704,665 Y274* probably null Het
Nuak1 T A 10: 84,374,802 Q474L probably damaging Het
Obscn A G 11: 58,998,505 S7523P unknown Het
Olfr625-ps1 T A 7: 103,683,473 C242S probably damaging Het
Oosp3 T A 19: 11,705,389 D140E probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Patl1 A G 19: 11,939,772 N661S probably benign Het
Pcyox1l G T 18: 61,698,473 N238K probably benign Het
Pmch A G 10: 88,091,149 T5A probably benign Het
Polr3h A G 15: 81,916,634 L169P probably damaging Het
Ptpn4 A G 1: 119,687,723 V567A probably damaging Het
Rasgrp2 T G 19: 6,402,513 F39V probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Sh3glb2 A T 2: 30,350,389 probably null Het
Slc46a3 A T 5: 147,893,890 N44K probably benign Het
Slc9b1 T A 3: 135,393,995 N425K probably benign Het
Slfn14 A T 11: 83,279,462 V452E probably damaging Het
Slfn8 A T 11: 83,003,335 M826K probably benign Het
Slit3 G A 11: 35,629,751 V572M probably benign Het
Smr3a C A 5: 88,008,014 probably null Het
Snap29 T C 16: 17,406,330 S70P probably damaging Het
Svopl T A 6: 38,017,014 probably benign Het
Tbc1d17 A T 7: 44,845,337 F186I probably damaging Het
Tgm6 T C 2: 130,141,256 V255A probably damaging Het
Tjp1 G T 7: 65,302,852 T1498K probably benign Het
Tkfc C A 19: 10,597,347 E176D probably benign Het
Tmem102 C T 11: 69,803,680 V489I probably damaging Het
Ttn A G 2: 76,721,437 V22930A probably damaging Het
Tyms A T 5: 30,073,359 probably null Het
Uaca T A 9: 60,840,956 D67E probably damaging Het
Unc119b G A 5: 115,127,449 probably benign Het
Usp29 A T 7: 6,961,745 T196S probably benign Het
Usp37 A G 1: 74,485,982 S228P probably damaging Het
Usp42 C A 5: 143,715,515 A918S probably benign Het
Vmn2r72 T A 7: 85,737,850 L835F probably benign Het
Vps13a T C 19: 16,660,530 T2396A probably benign Het
Whrn A T 4: 63,494,708 S176T probably damaging Het
Zbtb42 T C 12: 112,680,621 F410S probably damaging Het
Zfp616 T C 11: 74,083,126 S74P probably damaging Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46680792 missense probably benign 0.05
R8559:Dnah7c UTSW 1 46725139 missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46672541 missense probably benign 0.00
R8869:Dnah7c UTSW 1 46632344 missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46766656 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46665490 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46777736 missense probably benign 0.00
R9246:Dnah7c UTSW 1 46532774 missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46482008 missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46740726 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTAAGATTGACACTTTCCGGGAG -3'
(R):5'- AGACAGACCATTCTCTTCCATCAAG -3'

Sequencing Primer
(F):5'- CACTTTCCGGGAGATAATATAGTAGG -3'
(R):5'- CTTCCATCAAGAGTCATAGAGAAAGG -3'
Posted On 2017-02-28