Incidental Mutation 'R0566:Piwil2'
ID46198
Institutional Source Beutler Lab
Gene Symbol Piwil2
Ensembl Gene ENSMUSG00000033644
Gene Namepiwi-like RNA-mediated gene silencing 2
SynonymsMiwi like, mili
MMRRC Submission 038757-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0566 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70372477-70429383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70410394 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 323 (V323A)
Ref Sequence ENSEMBL: ENSMUSP00000047385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048129] [ENSMUST00000226229]
PDB Structure
Structure of extended Tudor domain TD3 from mouse TDRD1 in complex with MILI peptide containing dimethylarginine 45. [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048129
AA Change: V323A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047385
Gene: ENSMUSG00000033644
AA Change: V323A

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
DUF1785 335 386 7.44e-2 SMART
PAZ 386 524 1.92e-62 SMART
Piwi 666 957 2.45e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226229
Meta Mutation Damage Score 0.6565 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 96% (24/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL2 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testis weight, azoospermia, and male infertility associated with a complete arrest of spermatogenesis and increased apoptotic cell death during the early prophase of the first meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 122,781,527 L254P possibly damaging Het
Adamts6 C A 13: 104,444,927 A850E probably benign Het
Ccdc112 A C 18: 46,290,810 V287G probably damaging Het
Ctbp2 A G 7: 132,991,147 V811A probably damaging Het
Dchs1 A G 7: 105,759,195 V1810A probably benign Het
Dhx15 T G 5: 52,171,425 K287T probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fryl T C 5: 73,064,497 probably benign Het
Gnpda2 A G 5: 69,584,961 probably benign Het
Mto1 T C 9: 78,448,301 F2S possibly damaging Het
Nlrp1a A G 11: 71,122,942 L494P probably benign Het
Olfr456 T A 6: 42,487,091 Y34F probably damaging Het
Paqr8 C A 1: 20,935,463 H280Q possibly damaging Het
Perm1 A T 4: 156,217,859 M287L probably benign Het
Pon3 A G 6: 5,232,408 V131A possibly damaging Het
Prima1 C A 12: 103,197,314 A133S probably benign Het
Prl7c1 A G 13: 27,778,978 L14P probably damaging Het
Prr23a2 T A 9: 98,856,988 L133H possibly damaging Het
Samd3 T C 10: 26,244,498 V157A possibly damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tep1 A T 14: 50,845,414 probably null Het
Tmem208 T C 8: 105,334,843 V167A probably benign Het
Tnrc6a A T 7: 123,170,913 N642I probably benign Het
Vps26a A G 10: 62,480,546 probably benign Het
Zfp112 T C 7: 24,125,677 S357P probably benign Het
Other mutations in Piwil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Piwil2 APN 14 70398218 missense probably benign 0.35
IGL02215:Piwil2 APN 14 70391373 missense possibly damaging 0.50
IGL02427:Piwil2 APN 14 70398134 splice site probably benign
IGL02554:Piwil2 APN 14 70391486 splice site probably benign
R0257:Piwil2 UTSW 14 70422631 missense probably benign 0.00
R0800:Piwil2 UTSW 14 70409037 unclassified probably benign
R0828:Piwil2 UTSW 14 70376017 missense probably damaging 1.00
R0862:Piwil2 UTSW 14 70395374 missense probably benign 0.00
R0864:Piwil2 UTSW 14 70395374 missense probably benign 0.00
R0881:Piwil2 UTSW 14 70408927 missense probably benign 0.34
R1734:Piwil2 UTSW 14 70426505 critical splice donor site probably null
R1997:Piwil2 UTSW 14 70426658 missense possibly damaging 0.90
R2011:Piwil2 UTSW 14 70426634 missense probably damaging 1.00
R2043:Piwil2 UTSW 14 70391470 missense probably benign 0.00
R2347:Piwil2 UTSW 14 70408917 missense probably damaging 0.98
R2998:Piwil2 UTSW 14 70411238 missense probably damaging 1.00
R4402:Piwil2 UTSW 14 70408916 missense probably benign 0.01
R4455:Piwil2 UTSW 14 70390565 missense probably benign 0.02
R4611:Piwil2 UTSW 14 70402197 missense probably benign 0.07
R4763:Piwil2 UTSW 14 70376778 missense probably damaging 1.00
R4869:Piwil2 UTSW 14 70395362 missense probably benign 0.00
R5033:Piwil2 UTSW 14 70421593 missense possibly damaging 0.71
R5207:Piwil2 UTSW 14 70392517 missense probably damaging 1.00
R5395:Piwil2 UTSW 14 70395397 missense probably benign 0.01
R5486:Piwil2 UTSW 14 70401431 missense probably benign 0.01
R5504:Piwil2 UTSW 14 70389899 missense probably benign 0.01
R5629:Piwil2 UTSW 14 70422967 missense probably damaging 1.00
R5967:Piwil2 UTSW 14 70390564 missense probably benign 0.00
R6167:Piwil2 UTSW 14 70422893 critical splice donor site probably null
R6168:Piwil2 UTSW 14 70395351 missense probably benign 0.04
R6517:Piwil2 UTSW 14 70374336 missense probably benign 0.44
R7261:Piwil2 UTSW 14 70374411 missense probably damaging 1.00
R7727:Piwil2 UTSW 14 70394057 missense probably damaging 1.00
R7745:Piwil2 UTSW 14 70394189 missense probably benign
R7833:Piwil2 UTSW 14 70395441 missense probably benign 0.02
R7916:Piwil2 UTSW 14 70395441 missense probably benign 0.02
R8044:Piwil2 UTSW 14 70391438 missense possibly damaging 0.90
R8066:Piwil2 UTSW 14 70420719 missense probably benign 0.00
X0023:Piwil2 UTSW 14 70398199 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACTCCATCTGCCTACTCAGCTAC -3'
(R):5'- TTTGCCAGCACAGGCTGTGAAG -3'

Sequencing Primer
(F):5'- ACCTGACCTGTCGAGTGAG -3'
(R):5'- AAGCTACCTTTTGGGCTCTAGAAC -3'
Posted On2013-06-11