Incidental Mutation 'R5933:Tgm6'
ID461981
Institutional Source Beutler Lab
Gene Symbol Tgm6
Ensembl Gene ENSMUSG00000027403
Gene Nametransglutaminase 6
SynonymsTGM3L
MMRRC Submission 044127-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5933 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130112416-130154232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130141256 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 255 (V255A)
Ref Sequence ENSEMBL: ENSMUSP00000028888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028888]
Predicted Effect probably damaging
Transcript: ENSMUST00000028888
AA Change: V255A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028888
Gene: ENSMUSG00000027403
AA Change: V255A

DomainStartEndE-ValueType
Pfam:Transglut_N 5 119 3e-31 PFAM
TGc 266 359 3.48e-40 SMART
low complexity region 466 483 N/A INTRINSIC
Pfam:Transglut_C 495 600 2.4e-23 PFAM
Pfam:Transglut_C 607 704 4.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147616
Meta Mutation Damage Score 0.4873 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 94% (99/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the transglutaminase superfamily. It catalyzes the cross-linking of proteins and the conjugation of polyamines to proteins. Mutations in this gene are associated with spinocerebellar ataxia type 35 (SCA35). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,070,348 P1766L probably damaging Het
Abca13 A G 11: 9,249,658 Q119R possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aipl1 A C 11: 72,030,282 C237G probably benign Het
Ankdd1a C T 9: 65,509,696 A154T probably benign Het
Arglu1 T C 8: 8,690,047 S91G probably benign Het
Arhgef33 C A 17: 80,337,280 H13N probably benign Het
Atp1a4 A G 1: 172,232,274 I796T possibly damaging Het
Birc6 C G 17: 74,599,237 S1374R probably damaging Het
Birc6 T A 17: 74,599,238 S72T probably damaging Het
Bmpr1b T C 3: 141,871,367 *59W probably null Het
Btbd16 A T 7: 130,784,281 Q63L probably damaging Het
Cacna1c C T 6: 118,612,580 R1592H probably damaging Het
Caps2 G A 10: 112,215,446 E541K probably benign Het
Card9 T C 2: 26,352,497 E500G probably damaging Het
Carnmt1 T C 19: 18,704,105 V396A probably benign Het
Ccnl1 T A 3: 65,948,342 K320M probably damaging Het
Cdh20 A C 1: 104,984,671 D550A probably damaging Het
Cdhr1 T A 14: 37,089,462 T231S probably benign Het
Cenpe T C 3: 135,261,628 V2177A probably benign Het
Cfap69 A G 5: 5,640,183 C161R probably damaging Het
Ctsd C T 7: 142,376,579 V403I probably benign Het
Cyth1 C T 11: 118,185,759 probably null Het
Dazl A T 17: 50,287,753 probably null Het
Disp3 A T 4: 148,241,313 C1329* probably null Het
Dld C T 12: 31,333,983 V374I probably benign Het
Dnah7c T C 1: 46,519,215 Y494H probably damaging Het
Dnttip2 T A 3: 122,275,568 M144K probably benign Het
Drc1 A T 5: 30,345,529 D132V probably damaging Het
Enpp6 A G 8: 47,066,004 D269G probably benign Het
Ephx4 T A 5: 107,403,765 probably null Het
Evl T C 12: 108,683,257 S345P possibly damaging Het
Fam193a A T 5: 34,465,680 D1204V probably damaging Het
Fat2 A T 11: 55,284,051 D1945E probably damaging Het
Fat4 T C 3: 38,951,375 probably null Het
Fbln7 A T 2: 128,877,498 M72L probably benign Het
Flnc T C 6: 29,441,106 V353A probably damaging Het
Fry T C 5: 150,390,800 probably benign Het
Galnt14 A T 17: 73,526,305 C225S probably benign Het
Gapvd1 T C 2: 34,684,291 S1265G probably benign Het
Gm13030 A G 4: 138,871,204 F136S unknown Het
Gucy1a1 T C 3: 82,094,807 H655R probably damaging Het
Hk1 A G 10: 62,269,994 L890P probably damaging Het
Igfn1 T A 1: 135,970,603 R742* probably null Het
Igkv12-49 T C 6: 69,716,569 noncoding transcript Het
Igkv2-109 T A 6: 68,302,981 L62Q possibly damaging Het
Itgb3 A G 11: 104,637,979 T311A possibly damaging Het
Kl A G 5: 150,989,483 E899G probably damaging Het
Kyat3 A T 3: 142,723,260 D151V probably damaging Het
Morc2b A T 17: 33,138,609 M63K possibly damaging Het
Mtbp T A 15: 55,571,327 F298L possibly damaging Het
Mtmr3 C T 11: 4,498,951 V272I probably benign Het
Muc4 A G 16: 32,753,052 T977A probably benign Het
Nebl G A 2: 17,404,187 H367Y probably benign Het
Nop58 T A 1: 59,704,665 Y274* probably null Het
Nuak1 T A 10: 84,374,802 Q474L probably damaging Het
Obscn A G 11: 58,998,505 S7523P unknown Het
Olfr625-ps1 T A 7: 103,683,473 C242S probably damaging Het
Oosp3 T A 19: 11,705,389 D140E probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Patl1 A G 19: 11,939,772 N661S probably benign Het
Pcyox1l G T 18: 61,698,473 N238K probably benign Het
Pmch A G 10: 88,091,149 T5A probably benign Het
Polr3h A G 15: 81,916,634 L169P probably damaging Het
Ptpn4 A G 1: 119,687,723 V567A probably damaging Het
Rasgrp2 T G 19: 6,402,513 F39V probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Sh3glb2 A T 2: 30,350,389 probably null Het
Slc46a3 A T 5: 147,893,890 N44K probably benign Het
Slc9b1 T A 3: 135,393,995 N425K probably benign Het
Slfn14 A T 11: 83,279,462 V452E probably damaging Het
Slfn8 A T 11: 83,003,335 M826K probably benign Het
Slit3 G A 11: 35,629,751 V572M probably benign Het
Smr3a C A 5: 88,008,014 probably null Het
Snap29 T C 16: 17,406,330 S70P probably damaging Het
Svopl T A 6: 38,017,014 probably benign Het
Tbc1d17 A T 7: 44,845,337 F186I probably damaging Het
Tjp1 G T 7: 65,302,852 T1498K probably benign Het
Tkfc C A 19: 10,597,347 E176D probably benign Het
Tmem102 C T 11: 69,803,680 V489I probably damaging Het
Ttn A G 2: 76,721,437 V22930A probably damaging Het
Tyms A T 5: 30,073,359 probably null Het
Uaca T A 9: 60,840,956 D67E probably damaging Het
Unc119b G A 5: 115,127,449 probably benign Het
Usp29 A T 7: 6,961,745 T196S probably benign Het
Usp37 A G 1: 74,485,982 S228P probably damaging Het
Usp42 C A 5: 143,715,515 A918S probably benign Het
Vmn2r72 T A 7: 85,737,850 L835F probably benign Het
Vps13a T C 19: 16,660,530 T2396A probably benign Het
Whrn A T 4: 63,494,708 S176T probably damaging Het
Zbtb42 T C 12: 112,680,621 F410S probably damaging Het
Zfp616 T C 11: 74,083,126 S74P probably damaging Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Tgm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Tgm6 APN 2 130136495 missense probably benign 0.00
IGL01331:Tgm6 APN 2 130143618 splice site probably null
IGL01348:Tgm6 APN 2 130137379 missense probably damaging 1.00
IGL01787:Tgm6 APN 2 130151434 splice site probably benign
IGL02208:Tgm6 APN 2 130135870 missense probably benign 0.11
IGL02656:Tgm6 APN 2 130145103 missense probably damaging 1.00
IGL03280:Tgm6 APN 2 130138931 missense probably damaging 1.00
R0200:Tgm6 UTSW 2 130152945 splice site probably null
R0507:Tgm6 UTSW 2 130138831 missense possibly damaging 0.56
R0744:Tgm6 UTSW 2 130151761 missense probably benign 0.00
R0800:Tgm6 UTSW 2 130143422 missense possibly damaging 0.94
R1530:Tgm6 UTSW 2 130151282 missense possibly damaging 0.71
R1573:Tgm6 UTSW 2 130151740 missense probably benign 0.00
R1706:Tgm6 UTSW 2 130145159 missense possibly damaging 0.53
R2330:Tgm6 UTSW 2 130143242 missense probably damaging 1.00
R2881:Tgm6 UTSW 2 130137439 missense probably benign 0.04
R2882:Tgm6 UTSW 2 130137439 missense probably benign 0.04
R3622:Tgm6 UTSW 2 130151761 missense possibly damaging 0.86
R3624:Tgm6 UTSW 2 130151761 missense possibly damaging 0.86
R4370:Tgm6 UTSW 2 130143605 missense probably benign 0.12
R4664:Tgm6 UTSW 2 130137394 missense probably benign 0.05
R4664:Tgm6 UTSW 2 130141208 missense probably benign 0.34
R4983:Tgm6 UTSW 2 130141193 missense probably damaging 0.99
R5182:Tgm6 UTSW 2 130141302 missense probably damaging 0.98
R5397:Tgm6 UTSW 2 130141908 missense possibly damaging 0.90
R5411:Tgm6 UTSW 2 130145196 missense probably benign 0.01
R5683:Tgm6 UTSW 2 130138955 missense probably damaging 1.00
R6016:Tgm6 UTSW 2 130141228 missense probably damaging 0.99
R7252:Tgm6 UTSW 2 130144964 missense probably damaging 1.00
R7290:Tgm6 UTSW 2 130141190 missense probably damaging 1.00
R7581:Tgm6 UTSW 2 130141285 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGGCAAAGAGTGACCCC -3'
(R):5'- AACGAACTGTTTGGTTTCTCTC -3'

Sequencing Primer
(F):5'- TGGGATTCCAAAGCTTGAAGATG -3'
(R):5'- GTTTGGTTTCTCTCTTCCTTAACCAG -3'
Posted On2017-02-28