Incidental Mutation 'R5933:Slc9b1'
ID461988
Institutional Source Beutler Lab
Gene Symbol Slc9b1
Ensembl Gene ENSMUSG00000050150
Gene Namesolute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Synonyms
MMRRC Submission 044127-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5933 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location135348029-135397827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135393995 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 425 (N425K)
Ref Sequence ENSEMBL: ENSMUSP00000077644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078568] [ENSMUST00000161417]
Predicted Effect probably benign
Transcript: ENSMUST00000078568
AA Change: N425K

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077644
Gene: ENSMUSG00000050150
AA Change: N425K

DomainStartEndE-ValueType
low complexity region 32 105 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:Na_H_Exchanger 148 542 4.7e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160460
SMART Domains Protein: ENSMUSP00000124902
Gene: ENSMUSG00000050150

DomainStartEndE-ValueType
low complexity region 32 105 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:Na_H_Exchanger 149 363 1.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161417
SMART Domains Protein: ENSMUSP00000125203
Gene: ENSMUSG00000050150

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 2 75 1.1e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 94% (99/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium/hydrogen exchanger and transmembrane protein. Highly conserved orthologs of this gene have been found in other mammalian species. The expression of this gene may be limited to testis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,070,348 P1766L probably damaging Het
Abca13 A G 11: 9,249,658 Q119R possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aipl1 A C 11: 72,030,282 C237G probably benign Het
Ankdd1a C T 9: 65,509,696 A154T probably benign Het
Arglu1 T C 8: 8,690,047 S91G probably benign Het
Arhgef33 C A 17: 80,337,280 H13N probably benign Het
Atp1a4 A G 1: 172,232,274 I796T possibly damaging Het
Birc6 C G 17: 74,599,237 S1374R probably damaging Het
Birc6 T A 17: 74,599,238 S72T probably damaging Het
Bmpr1b T C 3: 141,871,367 *59W probably null Het
Btbd16 A T 7: 130,784,281 Q63L probably damaging Het
Cacna1c C T 6: 118,612,580 R1592H probably damaging Het
Caps2 G A 10: 112,215,446 E541K probably benign Het
Card9 T C 2: 26,352,497 E500G probably damaging Het
Carnmt1 T C 19: 18,704,105 V396A probably benign Het
Ccnl1 T A 3: 65,948,342 K320M probably damaging Het
Cdh20 A C 1: 104,984,671 D550A probably damaging Het
Cdhr1 T A 14: 37,089,462 T231S probably benign Het
Cenpe T C 3: 135,261,628 V2177A probably benign Het
Cfap69 A G 5: 5,640,183 C161R probably damaging Het
Ctsd C T 7: 142,376,579 V403I probably benign Het
Cyth1 C T 11: 118,185,759 probably null Het
Dazl A T 17: 50,287,753 probably null Het
Disp3 A T 4: 148,241,313 C1329* probably null Het
Dld C T 12: 31,333,983 V374I probably benign Het
Dnah7c T C 1: 46,519,215 Y494H probably damaging Het
Dnttip2 T A 3: 122,275,568 M144K probably benign Het
Drc1 A T 5: 30,345,529 D132V probably damaging Het
Enpp6 A G 8: 47,066,004 D269G probably benign Het
Ephx4 T A 5: 107,403,765 probably null Het
Evl T C 12: 108,683,257 S345P possibly damaging Het
Fam193a A T 5: 34,465,680 D1204V probably damaging Het
Fat2 A T 11: 55,284,051 D1945E probably damaging Het
Fat4 T C 3: 38,951,375 probably null Het
Fbln7 A T 2: 128,877,498 M72L probably benign Het
Flnc T C 6: 29,441,106 V353A probably damaging Het
Fry T C 5: 150,390,800 probably benign Het
Galnt14 A T 17: 73,526,305 C225S probably benign Het
Gapvd1 T C 2: 34,684,291 S1265G probably benign Het
Gm13030 A G 4: 138,871,204 F136S unknown Het
Gucy1a1 T C 3: 82,094,807 H655R probably damaging Het
Hk1 A G 10: 62,269,994 L890P probably damaging Het
Igfn1 T A 1: 135,970,603 R742* probably null Het
Igkv12-49 T C 6: 69,716,569 noncoding transcript Het
Igkv2-109 T A 6: 68,302,981 L62Q possibly damaging Het
Itgb3 A G 11: 104,637,979 T311A possibly damaging Het
Kl A G 5: 150,989,483 E899G probably damaging Het
Kyat3 A T 3: 142,723,260 D151V probably damaging Het
Morc2b A T 17: 33,138,609 M63K possibly damaging Het
Mtbp T A 15: 55,571,327 F298L possibly damaging Het
Mtmr3 C T 11: 4,498,951 V272I probably benign Het
Muc4 A G 16: 32,753,052 T977A probably benign Het
Nebl G A 2: 17,404,187 H367Y probably benign Het
Nop58 T A 1: 59,704,665 Y274* probably null Het
Nuak1 T A 10: 84,374,802 Q474L probably damaging Het
Obscn A G 11: 58,998,505 S7523P unknown Het
Olfr625-ps1 T A 7: 103,683,473 C242S probably damaging Het
Oosp3 T A 19: 11,705,389 D140E probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Patl1 A G 19: 11,939,772 N661S probably benign Het
Pcyox1l G T 18: 61,698,473 N238K probably benign Het
Pmch A G 10: 88,091,149 T5A probably benign Het
Polr3h A G 15: 81,916,634 L169P probably damaging Het
Ptpn4 A G 1: 119,687,723 V567A probably damaging Het
Rasgrp2 T G 19: 6,402,513 F39V probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Sh3glb2 A T 2: 30,350,389 probably null Het
Slc46a3 A T 5: 147,893,890 N44K probably benign Het
Slfn14 A T 11: 83,279,462 V452E probably damaging Het
Slfn8 A T 11: 83,003,335 M826K probably benign Het
Slit3 G A 11: 35,629,751 V572M probably benign Het
Smr3a C A 5: 88,008,014 probably null Het
Snap29 T C 16: 17,406,330 S70P probably damaging Het
Svopl T A 6: 38,017,014 probably benign Het
Tbc1d17 A T 7: 44,845,337 F186I probably damaging Het
Tgm6 T C 2: 130,141,256 V255A probably damaging Het
Tjp1 G T 7: 65,302,852 T1498K probably benign Het
Tkfc C A 19: 10,597,347 E176D probably benign Het
Tmem102 C T 11: 69,803,680 V489I probably damaging Het
Ttn A G 2: 76,721,437 V22930A probably damaging Het
Tyms A T 5: 30,073,359 probably null Het
Uaca T A 9: 60,840,956 D67E probably damaging Het
Unc119b G A 5: 115,127,449 probably benign Het
Usp29 A T 7: 6,961,745 T196S probably benign Het
Usp37 A G 1: 74,485,982 S228P probably damaging Het
Usp42 C A 5: 143,715,515 A918S probably benign Het
Vmn2r72 T A 7: 85,737,850 L835F probably benign Het
Vps13a T C 19: 16,660,530 T2396A probably benign Het
Whrn A T 4: 63,494,708 S176T probably damaging Het
Zbtb42 T C 12: 112,680,621 F410S probably damaging Het
Zfp616 T C 11: 74,083,126 S74P probably damaging Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Slc9b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Slc9b1 APN 3 135371982 unclassified probably null
IGL02793:Slc9b1 APN 3 135374406 unclassified probably benign
IGL02875:Slc9b1 APN 3 135374406 unclassified probably benign
IGL02977:Slc9b1 APN 3 135397723 missense probably damaging 1.00
IGL02990:Slc9b1 APN 3 135394983 splice site probably null
IGL03112:Slc9b1 APN 3 135397672 missense probably damaging 1.00
IGL03277:Slc9b1 APN 3 135390508 missense possibly damaging 0.46
IGL03409:Slc9b1 APN 3 135394909 missense probably damaging 0.99
R0190:Slc9b1 UTSW 3 135357673 missense unknown
R0329:Slc9b1 UTSW 3 135373235 nonsense probably null
R0591:Slc9b1 UTSW 3 135382832 missense possibly damaging 0.88
R0592:Slc9b1 UTSW 3 135394074 splice site probably benign
R0602:Slc9b1 UTSW 3 135397755 missense probably benign 0.00
R0893:Slc9b1 UTSW 3 135394890 missense probably benign 0.15
R1250:Slc9b1 UTSW 3 135348770 start codon destroyed probably null
R1619:Slc9b1 UTSW 3 135355004 splice site probably null
R1840:Slc9b1 UTSW 3 135357468 missense unknown
R3157:Slc9b1 UTSW 3 135371845 missense probably damaging 1.00
R3159:Slc9b1 UTSW 3 135371845 missense probably damaging 1.00
R4565:Slc9b1 UTSW 3 135382717 missense probably damaging 1.00
R5138:Slc9b1 UTSW 3 135357773 intron probably benign
R5154:Slc9b1 UTSW 3 135373179 missense probably damaging 1.00
R5429:Slc9b1 UTSW 3 135373263 critical splice donor site probably null
R5677:Slc9b1 UTSW 3 135357559 missense unknown
R5903:Slc9b1 UTSW 3 135392894 intron probably benign
R6593:Slc9b1 UTSW 3 135357458 start codon destroyed probably null
R6667:Slc9b1 UTSW 3 135371965 missense probably damaging 0.99
R6788:Slc9b1 UTSW 3 135357757 splice site probably null
RF006:Slc9b1 UTSW 3 135357542 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TATGTGCGCATCCTTAACCAAAC -3'
(R):5'- TGAGGGTCTTTAAAGCTCCTC -3'

Sequencing Primer
(F):5'- TGTTTTCAGACACACCGGAAG -3'
(R):5'- GGGTCTTTAAAGCTCCTCAAATACAC -3'
Posted On2017-02-28