Incidental Mutation 'R5933:Whrn'
ID 461992
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Name whirlin
Synonyms 1110035G07Rik, wi, Ush2d, Dfnb31, C430046P22Rik
MMRRC Submission 044127-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5933 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 63333147-63414228 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63412945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 176 (S176T)
Ref Sequence ENSEMBL: ENSMUSP00000103016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000063672] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294] [ENSMUST00000133425]
AlphaFold Q80VW5
Predicted Effect probably damaging
Transcript: ENSMUST00000063650
AA Change: S176T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137
AA Change: S176T

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063672
AA Change: S176T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065838
Gene: ENSMUSG00000039137
AA Change: S176T

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084510
AA Change: S176T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137
AA Change: S176T

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095037
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095038
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102867
AA Change: S176T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137
AA Change: S176T

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107393
AA Change: S176T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137
AA Change: S176T

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119294
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124016
Predicted Effect probably damaging
Transcript: ENSMUST00000133425
AA Change: S18T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119280
Gene: ENSMUSG00000039137
AA Change: S18T

DomainStartEndE-ValueType
PDZ 1 65 6.42e-13 SMART
internal_repeat_1 139 164 3.88e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140720
Meta Mutation Damage Score 0.6936 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 94% (99/105)
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,776,109 (GRCm39) P1766L probably damaging Het
Abca13 A G 11: 9,199,658 (GRCm39) Q119R possibly damaging Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Aipl1 A C 11: 71,921,108 (GRCm39) C237G probably benign Het
Ankdd1a C T 9: 65,416,978 (GRCm39) A154T probably benign Het
Arglu1 T C 8: 8,740,047 (GRCm39) S91G probably benign Het
Arhgef33 C A 17: 80,644,709 (GRCm39) H13N probably benign Het
Atp1a4 A G 1: 172,059,841 (GRCm39) I796T possibly damaging Het
Birc6 C G 17: 74,906,232 (GRCm39) S1374R probably damaging Het
Birc6 T A 17: 74,906,233 (GRCm39) S72T probably damaging Het
Bmpr1b T C 3: 141,577,128 (GRCm39) *59W probably null Het
Btbd16 A T 7: 130,386,011 (GRCm39) Q63L probably damaging Het
Cacna1c C T 6: 118,589,541 (GRCm39) R1592H probably damaging Het
Caps2 G A 10: 112,051,351 (GRCm39) E541K probably benign Het
Card9 T C 2: 26,242,509 (GRCm39) E500G probably damaging Het
Carnmt1 T C 19: 18,681,469 (GRCm39) V396A probably benign Het
Ccnl1 T A 3: 65,855,763 (GRCm39) K320M probably damaging Het
Cdh20 A C 1: 104,912,396 (GRCm39) D550A probably damaging Het
Cdhr1 T A 14: 36,811,419 (GRCm39) T231S probably benign Het
Cenpe T C 3: 134,967,389 (GRCm39) V2177A probably benign Het
Cfap69 A G 5: 5,690,183 (GRCm39) C161R probably damaging Het
Ctsd C T 7: 141,930,316 (GRCm39) V403I probably benign Het
Cyth1 C T 11: 118,076,585 (GRCm39) probably null Het
Dazl A T 17: 50,594,781 (GRCm39) probably null Het
Disp3 A T 4: 148,325,770 (GRCm39) C1329* probably null Het
Dld C T 12: 31,383,982 (GRCm39) V374I probably benign Het
Dnah7c T C 1: 46,558,375 (GRCm39) Y494H probably damaging Het
Dnttip2 T A 3: 122,069,217 (GRCm39) M144K probably benign Het
Drc1 A T 5: 30,502,873 (GRCm39) D132V probably damaging Het
Enpp6 A G 8: 47,519,039 (GRCm39) D269G probably benign Het
Ephx4 T A 5: 107,551,631 (GRCm39) probably null Het
Evl T C 12: 108,649,516 (GRCm39) S345P possibly damaging Het
Fam193a A T 5: 34,623,024 (GRCm39) D1204V probably damaging Het
Fat2 A T 11: 55,174,877 (GRCm39) D1945E probably damaging Het
Fat4 T C 3: 39,005,524 (GRCm39) probably null Het
Fbln7 A T 2: 128,719,418 (GRCm39) M72L probably benign Het
Flnc T C 6: 29,441,105 (GRCm39) V353A probably damaging Het
Fry T C 5: 150,314,265 (GRCm39) probably benign Het
Galnt14 A T 17: 73,833,300 (GRCm39) C225S probably benign Het
Gapvd1 T C 2: 34,574,303 (GRCm39) S1265G probably benign Het
Gm13030 A G 4: 138,598,515 (GRCm39) F136S unknown Het
Gucy1a1 T C 3: 82,002,114 (GRCm39) H655R probably damaging Het
Hk1 A G 10: 62,105,773 (GRCm39) L890P probably damaging Het
Igfn1 T A 1: 135,898,341 (GRCm39) R742* probably null Het
Igkv12-49 T C 6: 69,693,553 (GRCm39) noncoding transcript Het
Igkv2-109 T A 6: 68,279,965 (GRCm39) L62Q possibly damaging Het
Itgb3 A G 11: 104,528,805 (GRCm39) T311A possibly damaging Het
Kl A G 5: 150,912,948 (GRCm39) E899G probably damaging Het
Kyat3 A T 3: 142,429,021 (GRCm39) D151V probably damaging Het
Morc2b A T 17: 33,357,583 (GRCm39) M63K possibly damaging Het
Mtbp T A 15: 55,434,723 (GRCm39) F298L possibly damaging Het
Mtmr3 C T 11: 4,448,951 (GRCm39) V272I probably benign Het
Muc4 A G 16: 32,574,480 (GRCm39) T977A probably benign Het
Nebl G A 2: 17,408,998 (GRCm39) H367Y probably benign Het
Nop58 T A 1: 59,743,824 (GRCm39) Y274* probably null Het
Nuak1 T A 10: 84,210,666 (GRCm39) Q474L probably damaging Het
Obscn A G 11: 58,889,331 (GRCm39) S7523P unknown Het
Oosp3 T A 19: 11,682,753 (GRCm39) D140E probably benign Het
Or52z15 T A 7: 103,332,680 (GRCm39) C242S probably damaging Het
Padi2 G A 4: 140,644,952 (GRCm39) R62H probably benign Het
Patl1 A G 19: 11,917,136 (GRCm39) N661S probably benign Het
Pcyox1l G T 18: 61,831,544 (GRCm39) N238K probably benign Het
Pmch A G 10: 87,927,011 (GRCm39) T5A probably benign Het
Polr3h A G 15: 81,800,835 (GRCm39) L169P probably damaging Het
Ptpn4 A G 1: 119,615,453 (GRCm39) V567A probably damaging Het
Rasgrp2 T G 19: 6,452,543 (GRCm39) F39V probably damaging Het
Setd1b G A 5: 123,296,815 (GRCm39) probably benign Het
Sh3glb2 A T 2: 30,240,401 (GRCm39) probably null Het
Slc46a3 A T 5: 147,830,700 (GRCm39) N44K probably benign Het
Slc9b1 T A 3: 135,099,756 (GRCm39) N425K probably benign Het
Slfn14 A T 11: 83,170,288 (GRCm39) V452E probably damaging Het
Slfn8 A T 11: 82,894,161 (GRCm39) M826K probably benign Het
Slit3 G A 11: 35,520,578 (GRCm39) V572M probably benign Het
Smr3a C A 5: 88,155,873 (GRCm39) probably null Het
Snap29 T C 16: 17,224,194 (GRCm39) S70P probably damaging Het
Svopl T A 6: 37,993,949 (GRCm39) probably benign Het
Tbc1d17 A T 7: 44,494,761 (GRCm39) F186I probably damaging Het
Tgm6 T C 2: 129,983,176 (GRCm39) V255A probably damaging Het
Tjp1 G T 7: 64,952,600 (GRCm39) T1498K probably benign Het
Tkfc C A 19: 10,574,711 (GRCm39) E176D probably benign Het
Tmem102 C T 11: 69,694,506 (GRCm39) V489I probably damaging Het
Ttn A G 2: 76,551,781 (GRCm39) V22930A probably damaging Het
Tyms A T 5: 30,278,357 (GRCm39) probably null Het
Uaca T A 9: 60,748,238 (GRCm39) D67E probably damaging Het
Unc119b G A 5: 115,265,508 (GRCm39) probably benign Het
Usp29 A T 7: 6,964,744 (GRCm39) T196S probably benign Het
Usp37 A G 1: 74,525,141 (GRCm39) S228P probably damaging Het
Usp42 C A 5: 143,701,270 (GRCm39) A918S probably benign Het
Vmn2r72 T A 7: 85,387,058 (GRCm39) L835F probably benign Het
Vps13a T C 19: 16,637,894 (GRCm39) T2396A probably benign Het
Zbtb42 T C 12: 112,647,055 (GRCm39) F410S probably damaging Het
Zfp616 T C 11: 73,973,952 (GRCm39) S74P probably damaging Het
Zswim6 A G 13: 107,880,642 (GRCm39) noncoding transcript Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63,391,015 (GRCm39) missense probably damaging 1.00
IGL01643:Whrn APN 4 63,334,672 (GRCm39) missense possibly damaging 0.79
IGL02065:Whrn APN 4 63,336,822 (GRCm39) missense possibly damaging 0.52
IGL02119:Whrn APN 4 63,353,724 (GRCm39) missense probably damaging 0.99
IGL02589:Whrn APN 4 63,336,334 (GRCm39) nonsense probably null
IGL02638:Whrn APN 4 63,337,709 (GRCm39) missense possibly damaging 0.47
IGL02865:Whrn APN 4 63,333,729 (GRCm39) missense probably benign 0.08
IGL02934:Whrn APN 4 63,334,342 (GRCm39) missense probably damaging 1.00
IGL03372:Whrn APN 4 63,336,855 (GRCm39) missense probably damaging 0.96
R0090:Whrn UTSW 4 63,350,969 (GRCm39) missense possibly damaging 0.79
R0592:Whrn UTSW 4 63,333,804 (GRCm39) missense probably damaging 1.00
R0631:Whrn UTSW 4 63,337,726 (GRCm39) missense probably damaging 1.00
R1916:Whrn UTSW 4 63,412,969 (GRCm39) missense probably damaging 1.00
R1933:Whrn UTSW 4 63,333,876 (GRCm39) nonsense probably null
R1958:Whrn UTSW 4 63,353,666 (GRCm39) missense possibly damaging 0.62
R2255:Whrn UTSW 4 63,336,385 (GRCm39) missense possibly damaging 0.92
R2513:Whrn UTSW 4 63,353,649 (GRCm39) missense probably benign 0.22
R3699:Whrn UTSW 4 63,379,649 (GRCm39) splice site probably benign
R3919:Whrn UTSW 4 63,413,421 (GRCm39) nonsense probably null
R4016:Whrn UTSW 4 63,333,876 (GRCm39) nonsense probably null
R4241:Whrn UTSW 4 63,351,210 (GRCm39) unclassified probably benign
R4517:Whrn UTSW 4 63,379,517 (GRCm39) critical splice donor site probably null
R4739:Whrn UTSW 4 63,336,402 (GRCm39) missense probably damaging 1.00
R5207:Whrn UTSW 4 63,350,951 (GRCm39) missense probably damaging 1.00
R5281:Whrn UTSW 4 63,336,664 (GRCm39) missense probably benign 0.04
R5307:Whrn UTSW 4 63,350,080 (GRCm39) missense probably benign 0.01
R5463:Whrn UTSW 4 63,351,053 (GRCm39) missense probably benign 0.08
R5663:Whrn UTSW 4 63,336,685 (GRCm39) missense probably damaging 0.98
R5754:Whrn UTSW 4 63,334,825 (GRCm39) missense probably damaging 0.98
R6212:Whrn UTSW 4 63,412,923 (GRCm39) nonsense probably null
R6380:Whrn UTSW 4 63,336,829 (GRCm39) missense possibly damaging 0.90
R6381:Whrn UTSW 4 63,390,921 (GRCm39) missense probably benign 0.00
R7030:Whrn UTSW 4 63,413,368 (GRCm39) unclassified probably benign
R7350:Whrn UTSW 4 63,350,196 (GRCm39) missense possibly damaging 0.71
R7382:Whrn UTSW 4 63,336,573 (GRCm39) missense probably benign
R7419:Whrn UTSW 4 63,334,330 (GRCm39) missense possibly damaging 0.94
R8334:Whrn UTSW 4 63,413,047 (GRCm39) missense probably damaging 1.00
R9378:Whrn UTSW 4 63,350,079 (GRCm39) missense probably benign 0.00
X0009:Whrn UTSW 4 63,350,148 (GRCm39) missense probably benign 0.00
Z1176:Whrn UTSW 4 63,333,803 (GRCm39) missense probably damaging 1.00
Z1177:Whrn UTSW 4 63,336,736 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGATTTGGTATAAAAGATAGCAGC -3'
(R):5'- TGCTCTTCGACCAGTACACG -3'

Sequencing Primer
(F):5'- GATAGCAGCACAGGCAACCG -3'
(R):5'- ACCAGTACACGGCCGAG -3'
Posted On 2017-02-28