Incidental Mutation 'R5933:Disp3'
ID 461996
Institutional Source Beutler Lab
Gene Symbol Disp3
Ensembl Gene ENSMUSG00000041544
Gene Name dispatched RND transporter family member 3
Synonyms G630052C06Rik, Ptchd2
MMRRC Submission 044127-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5933 (G1)
Quality Score 130
Status Validated
Chromosome 4
Chromosomal Location 148324721-148372422 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 148325770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 1329 (C1329*)
Ref Sequence ENSEMBL: ENSMUSP00000038490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047720]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000047720
AA Change: C1329*
SMART Domains Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: C1329*

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Pfam:Patched 362 735 2.2e-21 PFAM
Pfam:MMPL 366 590 3.1e-14 PFAM
Pfam:Sterol-sensing 435 588 1.1e-17 PFAM
Pfam:Patched 1121 1301 1.6e-7 PFAM
transmembrane domain 1314 1333 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 94% (99/105)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,776,109 (GRCm39) P1766L probably damaging Het
Abca13 A G 11: 9,199,658 (GRCm39) Q119R possibly damaging Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Aipl1 A C 11: 71,921,108 (GRCm39) C237G probably benign Het
Ankdd1a C T 9: 65,416,978 (GRCm39) A154T probably benign Het
Arglu1 T C 8: 8,740,047 (GRCm39) S91G probably benign Het
Arhgef33 C A 17: 80,644,709 (GRCm39) H13N probably benign Het
Atp1a4 A G 1: 172,059,841 (GRCm39) I796T possibly damaging Het
Birc6 C G 17: 74,906,232 (GRCm39) S1374R probably damaging Het
Birc6 T A 17: 74,906,233 (GRCm39) S72T probably damaging Het
Bmpr1b T C 3: 141,577,128 (GRCm39) *59W probably null Het
Btbd16 A T 7: 130,386,011 (GRCm39) Q63L probably damaging Het
Cacna1c C T 6: 118,589,541 (GRCm39) R1592H probably damaging Het
Caps2 G A 10: 112,051,351 (GRCm39) E541K probably benign Het
Card9 T C 2: 26,242,509 (GRCm39) E500G probably damaging Het
Carnmt1 T C 19: 18,681,469 (GRCm39) V396A probably benign Het
Ccnl1 T A 3: 65,855,763 (GRCm39) K320M probably damaging Het
Cdh20 A C 1: 104,912,396 (GRCm39) D550A probably damaging Het
Cdhr1 T A 14: 36,811,419 (GRCm39) T231S probably benign Het
Cenpe T C 3: 134,967,389 (GRCm39) V2177A probably benign Het
Cfap69 A G 5: 5,690,183 (GRCm39) C161R probably damaging Het
Ctsd C T 7: 141,930,316 (GRCm39) V403I probably benign Het
Cyth1 C T 11: 118,076,585 (GRCm39) probably null Het
Dazl A T 17: 50,594,781 (GRCm39) probably null Het
Dld C T 12: 31,383,982 (GRCm39) V374I probably benign Het
Dnah7c T C 1: 46,558,375 (GRCm39) Y494H probably damaging Het
Dnttip2 T A 3: 122,069,217 (GRCm39) M144K probably benign Het
Drc1 A T 5: 30,502,873 (GRCm39) D132V probably damaging Het
Enpp6 A G 8: 47,519,039 (GRCm39) D269G probably benign Het
Ephx4 T A 5: 107,551,631 (GRCm39) probably null Het
Evl T C 12: 108,649,516 (GRCm39) S345P possibly damaging Het
Fam193a A T 5: 34,623,024 (GRCm39) D1204V probably damaging Het
Fat2 A T 11: 55,174,877 (GRCm39) D1945E probably damaging Het
Fat4 T C 3: 39,005,524 (GRCm39) probably null Het
Fbln7 A T 2: 128,719,418 (GRCm39) M72L probably benign Het
Flnc T C 6: 29,441,105 (GRCm39) V353A probably damaging Het
Fry T C 5: 150,314,265 (GRCm39) probably benign Het
Galnt14 A T 17: 73,833,300 (GRCm39) C225S probably benign Het
Gapvd1 T C 2: 34,574,303 (GRCm39) S1265G probably benign Het
Gm13030 A G 4: 138,598,515 (GRCm39) F136S unknown Het
Gucy1a1 T C 3: 82,002,114 (GRCm39) H655R probably damaging Het
Hk1 A G 10: 62,105,773 (GRCm39) L890P probably damaging Het
Igfn1 T A 1: 135,898,341 (GRCm39) R742* probably null Het
Igkv12-49 T C 6: 69,693,553 (GRCm39) noncoding transcript Het
Igkv2-109 T A 6: 68,279,965 (GRCm39) L62Q possibly damaging Het
Itgb3 A G 11: 104,528,805 (GRCm39) T311A possibly damaging Het
Kl A G 5: 150,912,948 (GRCm39) E899G probably damaging Het
Kyat3 A T 3: 142,429,021 (GRCm39) D151V probably damaging Het
Morc2b A T 17: 33,357,583 (GRCm39) M63K possibly damaging Het
Mtbp T A 15: 55,434,723 (GRCm39) F298L possibly damaging Het
Mtmr3 C T 11: 4,448,951 (GRCm39) V272I probably benign Het
Muc4 A G 16: 32,574,480 (GRCm39) T977A probably benign Het
Nebl G A 2: 17,408,998 (GRCm39) H367Y probably benign Het
Nop58 T A 1: 59,743,824 (GRCm39) Y274* probably null Het
Nuak1 T A 10: 84,210,666 (GRCm39) Q474L probably damaging Het
Obscn A G 11: 58,889,331 (GRCm39) S7523P unknown Het
Oosp3 T A 19: 11,682,753 (GRCm39) D140E probably benign Het
Or52z15 T A 7: 103,332,680 (GRCm39) C242S probably damaging Het
Padi2 G A 4: 140,644,952 (GRCm39) R62H probably benign Het
Patl1 A G 19: 11,917,136 (GRCm39) N661S probably benign Het
Pcyox1l G T 18: 61,831,544 (GRCm39) N238K probably benign Het
Pmch A G 10: 87,927,011 (GRCm39) T5A probably benign Het
Polr3h A G 15: 81,800,835 (GRCm39) L169P probably damaging Het
Ptpn4 A G 1: 119,615,453 (GRCm39) V567A probably damaging Het
Rasgrp2 T G 19: 6,452,543 (GRCm39) F39V probably damaging Het
Setd1b G A 5: 123,296,815 (GRCm39) probably benign Het
Sh3glb2 A T 2: 30,240,401 (GRCm39) probably null Het
Slc46a3 A T 5: 147,830,700 (GRCm39) N44K probably benign Het
Slc9b1 T A 3: 135,099,756 (GRCm39) N425K probably benign Het
Slfn14 A T 11: 83,170,288 (GRCm39) V452E probably damaging Het
Slfn8 A T 11: 82,894,161 (GRCm39) M826K probably benign Het
Slit3 G A 11: 35,520,578 (GRCm39) V572M probably benign Het
Smr3a C A 5: 88,155,873 (GRCm39) probably null Het
Snap29 T C 16: 17,224,194 (GRCm39) S70P probably damaging Het
Svopl T A 6: 37,993,949 (GRCm39) probably benign Het
Tbc1d17 A T 7: 44,494,761 (GRCm39) F186I probably damaging Het
Tgm6 T C 2: 129,983,176 (GRCm39) V255A probably damaging Het
Tjp1 G T 7: 64,952,600 (GRCm39) T1498K probably benign Het
Tkfc C A 19: 10,574,711 (GRCm39) E176D probably benign Het
Tmem102 C T 11: 69,694,506 (GRCm39) V489I probably damaging Het
Ttn A G 2: 76,551,781 (GRCm39) V22930A probably damaging Het
Tyms A T 5: 30,278,357 (GRCm39) probably null Het
Uaca T A 9: 60,748,238 (GRCm39) D67E probably damaging Het
Unc119b G A 5: 115,265,508 (GRCm39) probably benign Het
Usp29 A T 7: 6,964,744 (GRCm39) T196S probably benign Het
Usp37 A G 1: 74,525,141 (GRCm39) S228P probably damaging Het
Usp42 C A 5: 143,701,270 (GRCm39) A918S probably benign Het
Vmn2r72 T A 7: 85,387,058 (GRCm39) L835F probably benign Het
Vps13a T C 19: 16,637,894 (GRCm39) T2396A probably benign Het
Whrn A T 4: 63,412,945 (GRCm39) S176T probably damaging Het
Zbtb42 T C 12: 112,647,055 (GRCm39) F410S probably damaging Het
Zfp616 T C 11: 73,973,952 (GRCm39) S74P probably damaging Het
Zswim6 A G 13: 107,880,642 (GRCm39) noncoding transcript Het
Other mutations in Disp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Disp3 APN 4 148,325,991 (GRCm39) missense probably benign 0.10
IGL01065:Disp3 APN 4 148,345,640 (GRCm39) missense probably damaging 1.00
IGL01800:Disp3 APN 4 148,334,258 (GRCm39) nonsense probably null
IGL01947:Disp3 APN 4 148,344,976 (GRCm39) missense probably damaging 1.00
IGL02510:Disp3 APN 4 148,337,158 (GRCm39) missense probably benign 0.00
IGL02573:Disp3 APN 4 148,355,906 (GRCm39) missense probably damaging 1.00
IGL02728:Disp3 APN 4 148,356,495 (GRCm39) missense probably damaging 1.00
IGL02931:Disp3 APN 4 148,333,658 (GRCm39) missense possibly damaging 0.94
R0164:Disp3 UTSW 4 148,338,708 (GRCm39) missense probably damaging 0.96
R0164:Disp3 UTSW 4 148,338,708 (GRCm39) missense probably damaging 0.96
R0257:Disp3 UTSW 4 148,335,211 (GRCm39) missense possibly damaging 0.87
R0409:Disp3 UTSW 4 148,356,416 (GRCm39) missense probably damaging 1.00
R0557:Disp3 UTSW 4 148,325,861 (GRCm39) missense possibly damaging 0.64
R0576:Disp3 UTSW 4 148,326,047 (GRCm39) missense possibly damaging 0.89
R1495:Disp3 UTSW 4 148,334,282 (GRCm39) missense probably benign 0.00
R1526:Disp3 UTSW 4 148,344,373 (GRCm39) missense probably benign 0.00
R1791:Disp3 UTSW 4 148,325,975 (GRCm39) missense probably damaging 1.00
R1856:Disp3 UTSW 4 148,356,089 (GRCm39) missense probably damaging 1.00
R1987:Disp3 UTSW 4 148,343,210 (GRCm39) missense probably damaging 0.97
R2030:Disp3 UTSW 4 148,344,423 (GRCm39) missense probably damaging 1.00
R2271:Disp3 UTSW 4 148,356,059 (GRCm39) missense possibly damaging 0.87
R2373:Disp3 UTSW 4 148,343,252 (GRCm39) missense probably damaging 1.00
R2566:Disp3 UTSW 4 148,325,880 (GRCm39) missense probably damaging 1.00
R3731:Disp3 UTSW 4 148,337,284 (GRCm39) missense probably benign 0.03
R4359:Disp3 UTSW 4 148,356,389 (GRCm39) missense probably benign 0.03
R4762:Disp3 UTSW 4 148,356,575 (GRCm39) missense probably damaging 1.00
R4950:Disp3 UTSW 4 148,342,583 (GRCm39) missense possibly damaging 0.94
R4975:Disp3 UTSW 4 148,328,673 (GRCm39) missense possibly damaging 0.79
R5218:Disp3 UTSW 4 148,327,333 (GRCm39) missense possibly damaging 0.88
R5523:Disp3 UTSW 4 148,342,554 (GRCm39) missense probably benign 0.14
R5556:Disp3 UTSW 4 148,342,614 (GRCm39) missense probably benign 0.14
R5857:Disp3 UTSW 4 148,333,640 (GRCm39) missense probably benign 0.01
R5994:Disp3 UTSW 4 148,338,741 (GRCm39) missense possibly damaging 0.94
R6362:Disp3 UTSW 4 148,338,765 (GRCm39) missense possibly damaging 0.95
R6813:Disp3 UTSW 4 148,344,387 (GRCm39) missense probably benign 0.09
R7211:Disp3 UTSW 4 148,325,979 (GRCm39) missense probably damaging 0.98
R7470:Disp3 UTSW 4 148,345,527 (GRCm39) missense possibly damaging 0.88
R7535:Disp3 UTSW 4 148,327,323 (GRCm39) missense probably damaging 0.99
R8093:Disp3 UTSW 4 148,354,973 (GRCm39) missense possibly damaging 0.93
R8357:Disp3 UTSW 4 148,345,572 (GRCm39) missense possibly damaging 0.86
R8457:Disp3 UTSW 4 148,345,572 (GRCm39) missense possibly damaging 0.86
R8506:Disp3 UTSW 4 148,326,027 (GRCm39) missense possibly damaging 0.77
R9182:Disp3 UTSW 4 148,354,841 (GRCm39) missense probably damaging 1.00
R9219:Disp3 UTSW 4 148,334,317 (GRCm39) missense possibly damaging 0.74
R9680:Disp3 UTSW 4 148,356,101 (GRCm39) missense probably damaging 1.00
R9696:Disp3 UTSW 4 148,345,611 (GRCm39) missense probably damaging 0.97
Z1088:Disp3 UTSW 4 148,356,200 (GRCm39) missense possibly damaging 0.63
Z1176:Disp3 UTSW 4 148,335,414 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,335,171 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,334,304 (GRCm39) missense probably benign 0.01
Z1177:Disp3 UTSW 4 148,334,203 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,355,024 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCAGGCAAACTTCAGTGAAG -3'
(R):5'- GTTCGCCAAGTTCGGGAAGATC -3'

Sequencing Primer
(F):5'- CAAACTTCAGTGAAGGGGCCC -3'
(R):5'- GATCGTGGCACTCAACACAGG -3'
Posted On 2017-02-28