Incidental Mutation 'R0567:Col15a1'
ID46201
Institutional Source Beutler Lab
Gene Symbol Col15a1
Ensembl Gene ENSMUSG00000028339
Gene Namecollagen, type XV, alpha 1
Synonyms
MMRRC Submission 038758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0567 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location47208161-47313167 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 47293231 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 912 (V912L)
Ref Sequence ENSEMBL: ENSMUSP00000080921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082303] [ENSMUST00000102917] [ENSMUST00000107731] [ENSMUST00000140413] [ENSMUST00000146967]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082303
AA Change: V912L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080921
Gene: ENSMUSG00000028339
AA Change: V912L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSPN 40 228 2.53e-56 SMART
LamG 89 227 1.7e-7 SMART
low complexity region 236 251 N/A INTRINSIC
low complexity region 332 344 N/A INTRINSIC
low complexity region 541 567 N/A INTRINSIC
Pfam:Collagen 603 663 1.4e-10 PFAM
Pfam:Collagen 650 719 2.1e-9 PFAM
low complexity region 722 742 N/A INTRINSIC
low complexity region 750 759 N/A INTRINSIC
Pfam:Collagen 782 832 2.7e-10 PFAM
Pfam:Collagen 838 894 5.1e-10 PFAM
low complexity region 965 980 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
Pfam:Endostatin 1087 1164 9.3e-15 PFAM
Pfam:Endostatin 1148 1345 1.4e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102917
AA Change: V934L

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099981
Gene: ENSMUSG00000028339
AA Change: V934L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSPN 40 228 2.53e-56 SMART
LamG 89 227 1.7e-7 SMART
low complexity region 236 251 N/A INTRINSIC
low complexity region 332 344 N/A INTRINSIC
low complexity region 541 567 N/A INTRINSIC
Pfam:Collagen 603 666 5.6e-10 PFAM
Pfam:Collagen 659 720 3.1e-10 PFAM
low complexity region 737 764 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
Pfam:Collagen 804 854 9.5e-10 PFAM
Pfam:Collagen 860 916 1.8e-9 PFAM
low complexity region 987 1002 N/A INTRINSIC
low complexity region 1032 1042 N/A INTRINSIC
low complexity region 1050 1109 N/A INTRINSIC
Pfam:Endostatin 1112 1362 2.8e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107731
AA Change: V100L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103359
Gene: ENSMUSG00000028339
AA Change: V100L

DomainStartEndE-ValueType
Pfam:Collagen 6 81 6.5e-9 PFAM
Pfam:Collagen 48 102 3.8e-8 PFAM
low complexity region 153 168 N/A INTRINSIC
Pfam:Collagen 196 258 4.1e-8 PFAM
Pfam:Endostatin 275 355 2.5e-15 PFAM
Pfam:Endostatin 336 533 2.8e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140413
SMART Domains Protein: ENSMUSP00000119292
Gene: ENSMUSG00000028339

DomainStartEndE-ValueType
Pfam:Collagen 27 121 7.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146967
AA Change: V74L

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118637
Gene: ENSMUSG00000028339
AA Change: V74L

DomainStartEndE-ValueType
Pfam:Collagen 2 55 6.3e-11 PFAM
Pfam:Collagen 96 141 2.9e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XV collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Type XV collagen has a wide tissue distribution but the strongest expression is localized to basement membrane zones so it may function to adhere basement membranes to underlying connective tissue stroma. The proteolytically produced C-terminal fragment of type XV collagen is restin, a potentially antiangiogenic protein that is closely related to endostatin. Mouse studies have shown that collagen XV deficiency is associated with muscle and microvessel deterioration. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in abnormal muscle cells of variable size (including atrophic and split muscle cells), susceptibility to exercise-induced muscle injury, and abnormalities in heart and skeletal muscle capillary endothelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,228,016 E303G probably damaging Het
Akr1b3 A T 6: 34,304,345 probably null Het
Alox8 A T 11: 69,191,522 probably null Het
Apcdd1 G A 18: 62,934,036 E74K possibly damaging Het
Atr T C 9: 95,865,829 V388A probably benign Het
AW554918 G A 18: 25,400,035 E452K possibly damaging Het
C1galt1 A G 6: 7,866,874 D240G probably damaging Het
Ccdc130 A G 8: 84,260,665 L93P probably damaging Het
Ceacam10 T A 7: 24,778,409 D116E probably damaging Het
Cyp3a11 G A 5: 145,869,149 T136I probably damaging Het
Denr C T 5: 123,908,158 T17M probably benign Het
Doc2b A G 11: 75,780,124 F227S probably damaging Het
Dsp A T 13: 38,192,438 T1400S probably benign Het
Egfr A T 11: 16,872,873 D412V probably benign Het
Fryl C T 5: 73,065,391 G1949D possibly damaging Het
Gstp3 A T 19: 4,057,636 L176Q possibly damaging Het
Heatr5a T A 12: 51,910,089 N1075I probably damaging Het
Hist1h2ah T C 13: 22,035,564 probably benign Het
Ighv1-69 C T 12: 115,623,549 probably benign Het
Lama3 A G 18: 12,549,252 I1092V probably benign Het
Lipg A T 18: 74,957,369 H36Q probably benign Het
Myh7b T C 2: 155,626,398 W836R probably damaging Het
Oit3 A T 10: 59,435,978 C186S probably damaging Het
Olfr734 A T 14: 50,320,658 M59K probably damaging Het
P2ry2 T C 7: 100,998,541 T186A probably damaging Het
Pyroxd2 T C 19: 42,735,925 T300A probably benign Het
Rab26 C A 17: 24,529,582 V283F probably damaging Het
Rad50 C T 11: 53,654,956 R1180Q probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Shroom3 A G 5: 92,964,453 D1891G possibly damaging Het
Syne2 G A 12: 75,890,230 E201K probably damaging Het
Taf6 A T 5: 138,183,726 probably null Het
Tbc1d32 A T 10: 56,173,963 M493K possibly damaging Het
Uaca A G 9: 60,871,381 T1017A probably benign Het
Usp17le C T 7: 104,768,898 V346I possibly damaging Het
Vmn1r71 T C 7: 10,748,629 D44G probably damaging Het
Vmn2r80 A G 10: 79,194,831 I830M possibly damaging Het
Zfp994 T C 17: 22,200,468 Y500C possibly damaging Het
Zscan20 A G 4: 128,589,450 probably null Het
Other mutations in Col15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Col15a1 APN 4 47208450 missense possibly damaging 0.86
IGL01561:Col15a1 APN 4 47312118 missense possibly damaging 0.87
IGL01750:Col15a1 APN 4 47303897 missense probably damaging 1.00
IGL02112:Col15a1 APN 4 47253985 splice site probably benign
IGL02158:Col15a1 APN 4 47300606 splice site probably null
IGL02268:Col15a1 APN 4 47245380 missense probably damaging 0.99
IGL02325:Col15a1 APN 4 47289364 missense probably damaging 1.00
IGL02583:Col15a1 APN 4 47279866 missense probably benign 0.00
IGL02699:Col15a1 APN 4 47284471 unclassified probably benign
IGL03167:Col15a1 APN 4 47282635 missense probably damaging 0.99
IGL03174:Col15a1 APN 4 47282666 missense probably damaging 0.99
R0119:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0299:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0499:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0607:Col15a1 UTSW 4 47282654 missense probably damaging 0.99
R0992:Col15a1 UTSW 4 47300491 missense probably damaging 0.96
R1165:Col15a1 UTSW 4 47257275 splice site probably benign
R1191:Col15a1 UTSW 4 47254083 nonsense probably null
R1852:Col15a1 UTSW 4 47299278 critical splice donor site probably null
R2349:Col15a1 UTSW 4 47306742 missense probably damaging 0.99
R2512:Col15a1 UTSW 4 47245868 missense possibly damaging 0.95
R2517:Col15a1 UTSW 4 47208492 missense probably damaging 0.98
R2895:Col15a1 UTSW 4 47312091 missense possibly damaging 0.59
R3688:Col15a1 UTSW 4 47258689 missense probably benign 0.00
R3848:Col15a1 UTSW 4 47289374 missense possibly damaging 0.73
R4430:Col15a1 UTSW 4 47245705 missense probably damaging 1.00
R4587:Col15a1 UTSW 4 47257184 missense probably damaging 1.00
R4793:Col15a1 UTSW 4 47262997 missense possibly damaging 0.83
R4812:Col15a1 UTSW 4 47262479 missense possibly damaging 0.93
R4922:Col15a1 UTSW 4 47258719 missense probably benign
R5233:Col15a1 UTSW 4 47296112 missense possibly damaging 0.74
R5602:Col15a1 UTSW 4 47312087 missense probably damaging 1.00
R5786:Col15a1 UTSW 4 47280865 missense possibly damaging 0.84
R5910:Col15a1 UTSW 4 47289514 missense probably damaging 1.00
R5921:Col15a1 UTSW 4 47300602 missense probably damaging 0.99
R5974:Col15a1 UTSW 4 47258683 missense probably benign 0.02
R5985:Col15a1 UTSW 4 47284507 missense probably damaging 0.99
R6010:Col15a1 UTSW 4 47245630 missense probably benign 0.03
R6720:Col15a1 UTSW 4 47247552 critical splice donor site probably null
R6791:Col15a1 UTSW 4 47300518 missense probably damaging 1.00
R6855:Col15a1 UTSW 4 47245544 missense probably damaging 1.00
R6965:Col15a1 UTSW 4 47247533 missense probably damaging 0.96
R7201:Col15a1 UTSW 4 47307752 missense possibly damaging 0.92
R7261:Col15a1 UTSW 4 47269088 missense probably benign 0.03
R7273:Col15a1 UTSW 4 47284467 splice site probably null
R7413:Col15a1 UTSW 4 47245431 missense possibly damaging 0.81
R7658:Col15a1 UTSW 4 47245591 missense possibly damaging 0.46
R8032:Col15a1 UTSW 4 47288108 missense unknown
R8075:Col15a1 UTSW 4 47208359 missense probably benign 0.07
R8130:Col15a1 UTSW 4 47312196 missense probably damaging 0.97
R8536:Col15a1 UTSW 4 47208536 critical splice donor site probably null
Z1177:Col15a1 UTSW 4 47245807 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGTATGCCCCAGATGAGGGAG -3'
(R):5'- GGTACTTAGCCTGCTGCATGAAGAC -3'

Sequencing Primer
(F):5'- AGTGCTCTGGAAGCTACTCC -3'
(R):5'- CCTGCTGCATGAAGACATGAG -3'
Posted On2013-06-11