Mutagenetix > Incidental Mutations

Incidental Mutation 'R0567:Adamtsl1'

46202

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl1

Ensembl Gene

ENSMUSG00000066113

Gene Name

ADAMTS-like 1

Synonyms

5930437A14Rik, 6720426B09Rik, punctin-1

MMRRC Submission

038758-MU

Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R0567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85514172-86428385 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86228016 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 303 (E303G)

Ref Sequence

ENSEMBL: ENSMUSP00000119278 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048885] [ENSMUST00000107178] [ENSMUST00000141889]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048885
AA Change: E303G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000043073
Gene: ENSMUSG00000066113
AA Change: E303G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	379	438	2.05e-2	SMART
TSP1	439	493	3.99e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107178
AA Change: E303G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: E303G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	362	421	2.05e-2	SMART
TSP1	422	476	3.99e-4	SMART
TSP1	508	567	6.39e-3	SMART
TSP1	593	650	7.86e-3	SMART
TSP1	652	712	3.78e-5	SMART
TSP1	715	772	2.66e-2	SMART
TSP1	774	833	1.62e-4	SMART
IGc2	873	937	4.19e-6	SMART
low complexity region	1123	1142	N/A	INTRINSIC
IGc2	1175	1240	1.31e-7	SMART
IGc2	1282	1351	7.81e-15	SMART
IGc2	1400	1467	2.39e-10	SMART
TSP1	1481	1537	2.12e-1	SMART
TSP1	1540	1599	1.74e-4	SMART
TSP1	1600	1658	8.2e0	SMART
TSP1	1660	1717	1.96e-1	SMART
Pfam:PLAC	1721	1751	1.4e-9	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000136320
AA Change: E131G

SMART Domains

Protein: ENSMUSP00000123343
Gene: ENSMUSG00000066113
AA Change: E131G

Domain	Start	End	E-Value	Type
Pfam:ADAM_spacer1	15	125	2.7e-7	PFAM
TSP1	130	189	4.35e-2	SMART
TSP1	191	239	1.36e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000141889
AA Change: E303G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: E303G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	379	438	2.05e-2	SMART
TSP1	439	493	3.99e-4	SMART
TSP1	525	584	6.39e-3	SMART
TSP1	610	667	7.86e-3	SMART
TSP1	707	764	2.66e-2	SMART
TSP1	766	825	1.62e-4	SMART
IGc2	865	929	4.19e-6	SMART
low complexity region	1115	1134	N/A	INTRINSIC
IGc2	1167	1232	1.31e-7	SMART
IGc2	1274	1343	7.81e-15	SMART
IGc2	1392	1459	2.39e-10	SMART
TSP1	1473	1529	2.12e-1	SMART
TSP1	1532	1591	1.74e-4	SMART
TSP1	1592	1650	8.2e0	SMART
TSP1	1652	1709	1.96e-1	SMART
Pfam:PLAC	1712	1744	5.6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150043

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1b3	A	T	6: 34,304,345		probably null	Het
Alox8	A	T	11: 69,191,522		probably null	Het
Apcdd1	G	A	18: 62,934,036	E74K	possibly damaging	Het
Atr	T	C	9: 95,865,829	V388A	probably benign	Het
AW554918	G	A	18: 25,400,035	E452K	possibly damaging	Het
C1galt1	A	G	6: 7,866,874	D240G	probably damaging	Het
Ccdc130	A	G	8: 84,260,665	L93P	probably damaging	Het
Ceacam10	T	A	7: 24,778,409	D116E	probably damaging	Het
Col15a1	G	T	4: 47,293,231	V912L	possibly damaging	Het
Cyp3a11	G	A	5: 145,869,149	T136I	probably damaging	Het
Denr	C	T	5: 123,908,158	T17M	probably benign	Het
Doc2b	A	G	11: 75,780,124	F227S	probably damaging	Het
Dsp	A	T	13: 38,192,438	T1400S	probably benign	Het
Egfr	A	T	11: 16,872,873	D412V	probably benign	Het
Fryl	C	T	5: 73,065,391	G1949D	possibly damaging	Het
Gstp3	A	T	19: 4,057,636	L176Q	possibly damaging	Het
Heatr5a	T	A	12: 51,910,089	N1075I	probably damaging	Het
Hist1h2ah	T	C	13: 22,035,564		probably benign	Het
Ighv1-69	C	T	12: 115,623,549		probably benign	Het
Lama3	A	G	18: 12,549,252	I1092V	probably benign	Het
Lipg	A	T	18: 74,957,369	H36Q	probably benign	Het
Myh7b	T	C	2: 155,626,398	W836R	probably damaging	Het
Oit3	A	T	10: 59,435,978	C186S	probably damaging	Het
Olfr734	A	T	14: 50,320,658	M59K	probably damaging	Het
P2ry2	T	C	7: 100,998,541	T186A	probably damaging	Het
Pyroxd2	T	C	19: 42,735,925	T300A	probably benign	Het
Rab26	C	A	17: 24,529,582	V283F	probably damaging	Het
Rad50	C	T	11: 53,654,956	R1180Q	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Shroom3	A	G	5: 92,964,453	D1891G	possibly damaging	Het
Syne2	G	A	12: 75,890,230	E201K	probably damaging	Het
Taf6	A	T	5: 138,183,726		probably null	Het
Tbc1d32	A	T	10: 56,173,963	M493K	possibly damaging	Het
Uaca	A	G	9: 60,871,381	T1017A	probably benign	Het
Usp17le	C	T	7: 104,768,898	V346I	possibly damaging	Het
Vmn1r71	T	C	7: 10,748,629	D44G	probably damaging	Het
Vmn2r80	A	G	10: 79,194,831	I830M	possibly damaging	Het
Zfp994	T	C	17: 22,200,468	Y500C	possibly damaging	Het
Zscan20	A	G	4: 128,589,450		probably null	Het

Other mutations in Adamtsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Adamtsl1	APN	4	86385640	missense	probably benign	0.01
IGL00741:Adamtsl1	APN	4	86276948	missense	probably damaging	1.00
IGL00770:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00774:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00826:Adamtsl1	APN	4	86156804	missense	probably damaging	1.00
IGL00938:Adamtsl1	APN	4	86342278	missense	possibly damaging	0.93
IGL01012:Adamtsl1	APN	4	86342189	missense	possibly damaging	0.93
IGL01728:Adamtsl1	APN	4	86110837	missense	probably damaging	1.00
IGL01801:Adamtsl1	APN	4	86199322	missense	probably benign	0.23
IGL01922:Adamtsl1	APN	4	86249902	missense	probably damaging	1.00
IGL02006:Adamtsl1	APN	4	86199345	missense	probably damaging	1.00
IGL02192:Adamtsl1	APN	4	86228016	missense	probably damaging	1.00
IGL02351:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02358:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02373:Adamtsl1	APN	4	86249805	missense	probably damaging	1.00
IGL02660:Adamtsl1	APN	4	86232610	missense	probably damaging	1.00
IGL02964:Adamtsl1	APN	4	86424357	missense	probably damaging	1.00
IGL03233:Adamtsl1	APN	4	86342120	missense	probably damaging	1.00
IGL03297:Adamtsl1	APN	4	86423426	missense	probably damaging	0.98
IGL03326:Adamtsl1	APN	4	86252748	splice site	probably benign
PIT4378001:Adamtsl1	UTSW	4	86199364	missense	possibly damaging	0.93
PIT4418001:Adamtsl1	UTSW	4	86243724	missense	probably damaging	1.00
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0132:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0453:Adamtsl1	UTSW	4	86232615	missense	probably damaging	1.00
R0480:Adamtsl1	UTSW	4	86252818	missense	probably benign	0.08
R0496:Adamtsl1	UTSW	4	86341198	missense	probably damaging	1.00
R0538:Adamtsl1	UTSW	4	86343121	missense	probably benign	0.27
R0547:Adamtsl1	UTSW	4	86356355	missense	probably benign	0.37
R0568:Adamtsl1	UTSW	4	86418552	missense	probably damaging	1.00
R0639:Adamtsl1	UTSW	4	86277143	missense	probably damaging	1.00
R0931:Adamtsl1	UTSW	4	86249847	missense	probably benign	0.05
R1186:Adamtsl1	UTSW	4	86388509	missense	probably benign	0.00
R1387:Adamtsl1	UTSW	4	86374993	splice site	probably benign
R1459:Adamtsl1	UTSW	4	86425865	missense	probably damaging	1.00
R1518:Adamtsl1	UTSW	4	86342603	missense	probably damaging	0.99
R1532:Adamtsl1	UTSW	4	86248065	missense	probably benign	0.02
R1603:Adamtsl1	UTSW	4	86415530	missense	probably benign
R1931:Adamtsl1	UTSW	4	86342411	missense	possibly damaging	0.62
R2086:Adamtsl1	UTSW	4	86228012	missense	probably damaging	1.00
R2221:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2223:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2396:Adamtsl1	UTSW	4	86343119	nonsense	probably null
R2397:Adamtsl1	UTSW	4	86199357	missense	probably damaging	1.00
R2426:Adamtsl1	UTSW	4	86156788	missense	probably benign	0.01
R3121:Adamtsl1	UTSW	4	86337009	missense	probably damaging	1.00
R3715:Adamtsl1	UTSW	4	86216976	missense	probably benign	0.01
R3848:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3849:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3850:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R4194:Adamtsl1	UTSW	4	86054008	intron	probably benign
R4354:Adamtsl1	UTSW	4	86156684	missense	probably damaging	1.00
R4795:Adamtsl1	UTSW	4	86243769	critical splice donor site	probably null
R4830:Adamtsl1	UTSW	4	86356382	missense	probably damaging	0.97
R4874:Adamtsl1	UTSW	4	86342492	missense	possibly damaging	0.94
R4939:Adamtsl1	UTSW	4	86243725	missense	possibly damaging	0.95
R4942:Adamtsl1	UTSW	4	86341214	nonsense	probably null
R4947:Adamtsl1	UTSW	4	85764800	missense	possibly damaging	0.93
R4960:Adamtsl1	UTSW	4	86424173	nonsense	probably null
R4971:Adamtsl1	UTSW	4	86336931	missense	probably damaging	1.00
R5141:Adamtsl1	UTSW	4	86156850	missense	possibly damaging	0.77
R5213:Adamtsl1	UTSW	4	86385628	missense	possibly damaging	0.89
R5237:Adamtsl1	UTSW	4	86385669	critical splice donor site	probably null
R5250:Adamtsl1	UTSW	4	86216945	nonsense	probably null
R5411:Adamtsl1	UTSW	4	86388413	critical splice acceptor site	probably null
R5554:Adamtsl1	UTSW	4	86276945	missense	possibly damaging	0.69
R5631:Adamtsl1	UTSW	4	86276923	nonsense	probably null
R5739:Adamtsl1	UTSW	4	86232664	missense	probably damaging	1.00
R5905:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6028:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6044:Adamtsl1	UTSW	4	86212691	missense	probably damaging	1.00
R6261:Adamtsl1	UTSW	4	86336878	missense	probably benign	0.09
R6300:Adamtsl1	UTSW	4	86248017	missense	probably damaging	1.00
R6332:Adamtsl1	UTSW	4	86217011	missense	probably damaging	0.96
R6560:Adamtsl1	UTSW	4	86336893	missense	probably damaging	1.00
R6693:Adamtsl1	UTSW	4	86342886	missense	probably benign	0.27
R6736:Adamtsl1	UTSW	4	86342247	missense	probably damaging	1.00
R6964:Adamtsl1	UTSW	4	86156854	missense	probably damaging	1.00
R7064:Adamtsl1	UTSW	4	86342041	missense	possibly damaging	0.80
R7434:Adamtsl1	UTSW	4	86425878	missense	probably damaging	0.99
R7477:Adamtsl1	UTSW	4	86415651	missense	probably damaging	1.00
R7545:Adamtsl1	UTSW	4	85764855	missense	probably damaging	1.00
R7556:Adamtsl1	UTSW	4	86277121	missense	probably benign	0.19
R7580:Adamtsl1	UTSW	4	86054064	missense	possibly damaging	0.53
R7593:Adamtsl1	UTSW	4	86341213	missense	probably damaging	1.00
R7710:Adamtsl1	UTSW	4	86232573	missense

Predicted Primers

PCR Primer
(F):5'- GCATTCTCAGCCAAGGTTACCAGAG -3'
(R):5'- AGCTGCTGTTGGAGAGGATACCAC -3'

Sequencing Primer
(F):5'- GGTTACCAGAGACCTAGAAGCTATC -3'
(R):5'- CTGTTGGAGAGGATACCACTACTC -3'

Posted On

2013-06-11