Incidental Mutation 'R5933:Dld'
ID462042
Institutional Source Beutler Lab
Gene Symbol Dld
Ensembl Gene ENSMUSG00000020664
Gene Namedihydrolipoamide dehydrogenase
Synonymsbranched chain alpha-keto acid dehydrogenase complex subunit E3, dihydrolipoyl dehydrogenase
MMRRC Submission 044127-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5933 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31331277-31351453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31333983 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 374 (V374I)
Ref Sequence ENSEMBL: ENSMUSP00000106481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000110857] [ENSMUST00000169088]
Predicted Effect probably benign
Transcript: ENSMUST00000002979
SMART Domains Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
EGF_Lam 558 602 3.4e-8 SMART
EGF_Lam 821 866 4.99e-15 SMART
EGF_Lam 869 912 2.38e-12 SMART
EGF_Lam 915 962 2.4e-8 SMART
EGF_Lam 965 1021 1.41e-5 SMART
EGF_Lam 1024 1073 4.81e-8 SMART
EGF_Lam 1076 1129 3.81e-11 SMART
EGF_Lam 1132 1177 5.61e-9 SMART
EGF_Lam 1180 1224 2.89e-11 SMART
coiled coil region 1329 1360 N/A INTRINSIC
low complexity region 1468 1480 N/A INTRINSIC
coiled coil region 1497 1551 N/A INTRINSIC
coiled coil region 1600 1826 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110857
AA Change: V374I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106481
Gene: ENSMUSG00000020664
AA Change: V374I

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 42 370 2.3e-71 PFAM
Pfam:FAD_binding_2 43 83 2.5e-7 PFAM
Pfam:GIDA 43 111 1.7e-8 PFAM
Pfam:FAD_oxidored 43 135 4.3e-10 PFAM
Pfam:NAD_binding_8 46 100 1.4e-6 PFAM
Pfam:Pyr_redox 215 298 4.9e-17 PFAM
Pfam:Pyr_redox_dim 389 498 1.6e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169088
SMART Domains Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900

DomainStartEndE-ValueType
LamNT 29 269 3.24e-96 SMART
EGF_Lam 271 332 1.34e-6 SMART
EGF_Lam 335 395 1.33e-10 SMART
EGF_Lam 398 455 2.89e-11 SMART
EGF_Lam 458 507 2.89e-11 SMART
EGF_Lam 510 554 3.4e-8 SMART
EGF_Lam 773 818 4.99e-15 SMART
EGF_Lam 821 864 2.38e-12 SMART
EGF_Lam 867 914 2.4e-8 SMART
EGF_Lam 917 973 1.41e-5 SMART
EGF_Lam 976 1025 4.81e-8 SMART
EGF_Lam 1028 1081 3.81e-11 SMART
EGF_Lam 1084 1129 5.61e-9 SMART
EGF_Lam 1132 1176 2.89e-11 SMART
coiled coil region 1281 1312 N/A INTRINSIC
low complexity region 1420 1432 N/A INTRINSIC
coiled coil region 1449 1503 N/A INTRINSIC
coiled coil region 1552 1778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218624
Meta Mutation Damage Score 0.1166 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 94% (99/105)
MGI Phenotype FUNCTION: This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In homodimeric form, the encoded protein functions as a dehydrogenase and is found in several multi-enzyme complexes that regulate energy metabolism. However, as a monomer, this protein can function as a protease. [provided by RefSeq, Jan 2014]
PHENOTYPE: Embryos homozygous for a targeted null mutation exhibit a developmental delay at 7.5 days postcoitum and are resorbed by 9.5 days postcoitum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,070,348 P1766L probably damaging Het
Abca13 A G 11: 9,249,658 Q119R possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aipl1 A C 11: 72,030,282 C237G probably benign Het
Ankdd1a C T 9: 65,509,696 A154T probably benign Het
Arglu1 T C 8: 8,690,047 S91G probably benign Het
Arhgef33 C A 17: 80,337,280 H13N probably benign Het
Atp1a4 A G 1: 172,232,274 I796T possibly damaging Het
Birc6 C G 17: 74,599,237 S1374R probably damaging Het
Birc6 T A 17: 74,599,238 S72T probably damaging Het
Bmpr1b T C 3: 141,871,367 *59W probably null Het
Btbd16 A T 7: 130,784,281 Q63L probably damaging Het
Cacna1c C T 6: 118,612,580 R1592H probably damaging Het
Caps2 G A 10: 112,215,446 E541K probably benign Het
Card9 T C 2: 26,352,497 E500G probably damaging Het
Carnmt1 T C 19: 18,704,105 V396A probably benign Het
Ccnl1 T A 3: 65,948,342 K320M probably damaging Het
Cdh20 A C 1: 104,984,671 D550A probably damaging Het
Cdhr1 T A 14: 37,089,462 T231S probably benign Het
Cenpe T C 3: 135,261,628 V2177A probably benign Het
Cfap69 A G 5: 5,640,183 C161R probably damaging Het
Ctsd C T 7: 142,376,579 V403I probably benign Het
Cyth1 C T 11: 118,185,759 probably null Het
Dazl A T 17: 50,287,753 probably null Het
Disp3 A T 4: 148,241,313 C1329* probably null Het
Dnah7c T C 1: 46,519,215 Y494H probably damaging Het
Dnttip2 T A 3: 122,275,568 M144K probably benign Het
Drc1 A T 5: 30,345,529 D132V probably damaging Het
Enpp6 A G 8: 47,066,004 D269G probably benign Het
Ephx4 T A 5: 107,403,765 probably null Het
Evl T C 12: 108,683,257 S345P possibly damaging Het
Fam193a A T 5: 34,465,680 D1204V probably damaging Het
Fat2 A T 11: 55,284,051 D1945E probably damaging Het
Fat4 T C 3: 38,951,375 probably null Het
Fbln7 A T 2: 128,877,498 M72L probably benign Het
Flnc T C 6: 29,441,106 V353A probably damaging Het
Fry T C 5: 150,390,800 probably benign Het
Galnt14 A T 17: 73,526,305 C225S probably benign Het
Gapvd1 T C 2: 34,684,291 S1265G probably benign Het
Gm13030 A G 4: 138,871,204 F136S unknown Het
Gucy1a1 T C 3: 82,094,807 H655R probably damaging Het
Hk1 A G 10: 62,269,994 L890P probably damaging Het
Igfn1 T A 1: 135,970,603 R742* probably null Het
Igkv12-49 T C 6: 69,716,569 noncoding transcript Het
Igkv2-109 T A 6: 68,302,981 L62Q possibly damaging Het
Itgb3 A G 11: 104,637,979 T311A possibly damaging Het
Kl A G 5: 150,989,483 E899G probably damaging Het
Kyat3 A T 3: 142,723,260 D151V probably damaging Het
Morc2b A T 17: 33,138,609 M63K possibly damaging Het
Mtbp T A 15: 55,571,327 F298L possibly damaging Het
Mtmr3 C T 11: 4,498,951 V272I probably benign Het
Muc4 A G 16: 32,753,052 T977A probably benign Het
Nebl G A 2: 17,404,187 H367Y probably benign Het
Nop58 T A 1: 59,704,665 Y274* probably null Het
Nuak1 T A 10: 84,374,802 Q474L probably damaging Het
Obscn A G 11: 58,998,505 S7523P unknown Het
Olfr625-ps1 T A 7: 103,683,473 C242S probably damaging Het
Oosp3 T A 19: 11,705,389 D140E probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Patl1 A G 19: 11,939,772 N661S probably benign Het
Pcyox1l G T 18: 61,698,473 N238K probably benign Het
Pmch A G 10: 88,091,149 T5A probably benign Het
Polr3h A G 15: 81,916,634 L169P probably damaging Het
Ptpn4 A G 1: 119,687,723 V567A probably damaging Het
Rasgrp2 T G 19: 6,402,513 F39V probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Sh3glb2 A T 2: 30,350,389 probably null Het
Slc46a3 A T 5: 147,893,890 N44K probably benign Het
Slc9b1 T A 3: 135,393,995 N425K probably benign Het
Slfn14 A T 11: 83,279,462 V452E probably damaging Het
Slfn8 A T 11: 83,003,335 M826K probably benign Het
Slit3 G A 11: 35,629,751 V572M probably benign Het
Smr3a C A 5: 88,008,014 probably null Het
Snap29 T C 16: 17,406,330 S70P probably damaging Het
Svopl T A 6: 38,017,014 probably benign Het
Tbc1d17 A T 7: 44,845,337 F186I probably damaging Het
Tgm6 T C 2: 130,141,256 V255A probably damaging Het
Tjp1 G T 7: 65,302,852 T1498K probably benign Het
Tkfc C A 19: 10,597,347 E176D probably benign Het
Tmem102 C T 11: 69,803,680 V489I probably damaging Het
Ttn A G 2: 76,721,437 V22930A probably damaging Het
Tyms A T 5: 30,073,359 probably null Het
Uaca T A 9: 60,840,956 D67E probably damaging Het
Unc119b G A 5: 115,127,449 probably benign Het
Usp29 A T 7: 6,961,745 T196S probably benign Het
Usp37 A G 1: 74,485,982 S228P probably damaging Het
Usp42 C A 5: 143,715,515 A918S probably benign Het
Vmn2r72 T A 7: 85,737,850 L835F probably benign Het
Vps13a T C 19: 16,660,530 T2396A probably benign Het
Whrn A T 4: 63,494,708 S176T probably damaging Het
Zbtb42 T C 12: 112,680,621 F410S probably damaging Het
Zfp616 T C 11: 74,083,126 S74P probably damaging Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Dld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Dld APN 12 31335577 missense probably benign
IGL00656:Dld APN 12 31349595 critical splice donor site probably null
IGL00907:Dld APN 12 31332330 unclassified probably benign
IGL01870:Dld APN 12 31335467 missense possibly damaging 0.89
IGL02654:Dld APN 12 31333917 missense probably benign 0.19
IGL02666:Dld APN 12 31332409 missense probably null 0.00
PIT4544001:Dld UTSW 12 31335557 nonsense probably null
R0973:Dld UTSW 12 31334054 missense probably damaging 1.00
R1748:Dld UTSW 12 31334746 missense probably benign
R2225:Dld UTSW 12 31341449 missense probably benign 0.01
R4614:Dld UTSW 12 31333945 nonsense probably null
R5966:Dld UTSW 12 31340326 missense probably damaging 1.00
R6088:Dld UTSW 12 31340989 missense probably benign
R6190:Dld UTSW 12 31344848 missense probably damaging 1.00
R6327:Dld UTSW 12 31332191 missense probably benign
R6750:Dld UTSW 12 31332214 missense probably benign 0.00
R7149:Dld UTSW 12 31335590 missense probably benign
R7414:Dld UTSW 12 31335526 missense probably damaging 1.00
R7730:Dld UTSW 12 31340865 missense probably benign 0.00
X0065:Dld UTSW 12 31341389 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCTTTCTAGTGACCGGTG -3'
(R):5'- GGCTCAAAGATTAGATACTTAGCTC -3'

Sequencing Primer
(F):5'- GACCGGTGCCATTAGTTTAAGCC -3'
(R):5'- ACTTAGCTCTGGTGTCTAAAGAGC -3'
Posted On2017-02-28