Incidental Mutation 'R5933:Morc2b'
ID462053
Institutional Source Beutler Lab
Gene Symbol Morc2b
Ensembl Gene ENSMUSG00000048602
Gene Namemicrorchidia 2B
Synonyms
MMRRC Submission 044127-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R5933 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33135588-33139683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33138609 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 63 (M63K)
Ref Sequence ENSEMBL: ENSMUSP00000123354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053896
AA Change: M63K

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: M63K

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 495 541 1.9e-16 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131954
AA Change: M63K

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: M63K

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 494 543 7.7e-18 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Meta Mutation Damage Score 0.2894 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 94% (99/105)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,070,348 P1766L probably damaging Het
Abca13 A G 11: 9,249,658 Q119R possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aipl1 A C 11: 72,030,282 C237G probably benign Het
Ankdd1a C T 9: 65,509,696 A154T probably benign Het
Arglu1 T C 8: 8,690,047 S91G probably benign Het
Arhgef33 C A 17: 80,337,280 H13N probably benign Het
Atp1a4 A G 1: 172,232,274 I796T possibly damaging Het
Birc6 C G 17: 74,599,237 S1374R probably damaging Het
Birc6 T A 17: 74,599,238 S72T probably damaging Het
Bmpr1b T C 3: 141,871,367 *59W probably null Het
Btbd16 A T 7: 130,784,281 Q63L probably damaging Het
Cacna1c C T 6: 118,612,580 R1592H probably damaging Het
Caps2 G A 10: 112,215,446 E541K probably benign Het
Card9 T C 2: 26,352,497 E500G probably damaging Het
Carnmt1 T C 19: 18,704,105 V396A probably benign Het
Ccnl1 T A 3: 65,948,342 K320M probably damaging Het
Cdh20 A C 1: 104,984,671 D550A probably damaging Het
Cdhr1 T A 14: 37,089,462 T231S probably benign Het
Cenpe T C 3: 135,261,628 V2177A probably benign Het
Cfap69 A G 5: 5,640,183 C161R probably damaging Het
Ctsd C T 7: 142,376,579 V403I probably benign Het
Cyth1 C T 11: 118,185,759 probably null Het
Dazl A T 17: 50,287,753 probably null Het
Disp3 A T 4: 148,241,313 C1329* probably null Het
Dld C T 12: 31,333,983 V374I probably benign Het
Dnah7c T C 1: 46,519,215 Y494H probably damaging Het
Dnttip2 T A 3: 122,275,568 M144K probably benign Het
Drc1 A T 5: 30,345,529 D132V probably damaging Het
Enpp6 A G 8: 47,066,004 D269G probably benign Het
Ephx4 T A 5: 107,403,765 probably null Het
Evl T C 12: 108,683,257 S345P possibly damaging Het
Fam193a A T 5: 34,465,680 D1204V probably damaging Het
Fat2 A T 11: 55,284,051 D1945E probably damaging Het
Fat4 T C 3: 38,951,375 probably null Het
Fbln7 A T 2: 128,877,498 M72L probably benign Het
Flnc T C 6: 29,441,106 V353A probably damaging Het
Fry T C 5: 150,390,800 probably benign Het
Galnt14 A T 17: 73,526,305 C225S probably benign Het
Gapvd1 T C 2: 34,684,291 S1265G probably benign Het
Gm13030 A G 4: 138,871,204 F136S unknown Het
Gucy1a1 T C 3: 82,094,807 H655R probably damaging Het
Hk1 A G 10: 62,269,994 L890P probably damaging Het
Igfn1 T A 1: 135,970,603 R742* probably null Het
Igkv12-49 T C 6: 69,716,569 noncoding transcript Het
Igkv2-109 T A 6: 68,302,981 L62Q possibly damaging Het
Itgb3 A G 11: 104,637,979 T311A possibly damaging Het
Kl A G 5: 150,989,483 E899G probably damaging Het
Kyat3 A T 3: 142,723,260 D151V probably damaging Het
Mtbp T A 15: 55,571,327 F298L possibly damaging Het
Mtmr3 C T 11: 4,498,951 V272I probably benign Het
Muc4 A G 16: 32,753,052 T977A probably benign Het
Nebl G A 2: 17,404,187 H367Y probably benign Het
Nop58 T A 1: 59,704,665 Y274* probably null Het
Nuak1 T A 10: 84,374,802 Q474L probably damaging Het
Obscn A G 11: 58,998,505 S7523P unknown Het
Olfr625-ps1 T A 7: 103,683,473 C242S probably damaging Het
Oosp3 T A 19: 11,705,389 D140E probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Patl1 A G 19: 11,939,772 N661S probably benign Het
Pcyox1l G T 18: 61,698,473 N238K probably benign Het
Pmch A G 10: 88,091,149 T5A probably benign Het
Polr3h A G 15: 81,916,634 L169P probably damaging Het
Ptpn4 A G 1: 119,687,723 V567A probably damaging Het
Rasgrp2 T G 19: 6,402,513 F39V probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Sh3glb2 A T 2: 30,350,389 probably null Het
Slc46a3 A T 5: 147,893,890 N44K probably benign Het
Slc9b1 T A 3: 135,393,995 N425K probably benign Het
Slfn14 A T 11: 83,279,462 V452E probably damaging Het
Slfn8 A T 11: 83,003,335 M826K probably benign Het
Slit3 G A 11: 35,629,751 V572M probably benign Het
Smr3a C A 5: 88,008,014 probably null Het
Snap29 T C 16: 17,406,330 S70P probably damaging Het
Svopl T A 6: 38,017,014 probably benign Het
Tbc1d17 A T 7: 44,845,337 F186I probably damaging Het
Tgm6 T C 2: 130,141,256 V255A probably damaging Het
Tjp1 G T 7: 65,302,852 T1498K probably benign Het
Tkfc C A 19: 10,597,347 E176D probably benign Het
Tmem102 C T 11: 69,803,680 V489I probably damaging Het
Ttn A G 2: 76,721,437 V22930A probably damaging Het
Tyms A T 5: 30,073,359 probably null Het
Uaca T A 9: 60,840,956 D67E probably damaging Het
Unc119b G A 5: 115,127,449 probably benign Het
Usp29 A T 7: 6,961,745 T196S probably benign Het
Usp37 A G 1: 74,485,982 S228P probably damaging Het
Usp42 C A 5: 143,715,515 A918S probably benign Het
Vmn2r72 T A 7: 85,737,850 L835F probably benign Het
Vps13a T C 19: 16,660,530 T2396A probably benign Het
Whrn A T 4: 63,494,708 S176T probably damaging Het
Zbtb42 T C 12: 112,680,621 F410S probably damaging Het
Zfp616 T C 11: 74,083,126 S74P probably damaging Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Morc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Morc2b APN 17 33137319 missense possibly damaging 0.47
IGL01369:Morc2b APN 17 33138165 missense probably benign 0.12
IGL01533:Morc2b APN 17 33135721 utr 3 prime probably benign
IGL02003:Morc2b APN 17 33138324 missense probably benign 0.07
IGL02028:Morc2b APN 17 33137413 missense possibly damaging 0.78
IGL02152:Morc2b APN 17 33137943 missense probably damaging 1.00
IGL02341:Morc2b APN 17 33137307 missense probably damaging 1.00
IGL02976:Morc2b APN 17 33137523 missense possibly damaging 0.90
IGL03293:Morc2b APN 17 33138363 missense probably damaging 1.00
PIT4283001:Morc2b UTSW 17 33136068 missense probably benign 0.00
R0056:Morc2b UTSW 17 33138759 missense possibly damaging 0.78
R0116:Morc2b UTSW 17 33137041 missense probably damaging 1.00
R0179:Morc2b UTSW 17 33136982 nonsense probably null
R0533:Morc2b UTSW 17 33135932 nonsense probably null
R0556:Morc2b UTSW 17 33137838 missense probably benign 0.05
R0629:Morc2b UTSW 17 33135807 missense probably benign 0.00
R0635:Morc2b UTSW 17 33137687 missense possibly damaging 0.90
R0840:Morc2b UTSW 17 33136112 missense probably benign 0.01
R1205:Morc2b UTSW 17 33135934 missense probably damaging 1.00
R1566:Morc2b UTSW 17 33136974 missense probably benign 0.02
R1676:Morc2b UTSW 17 33135981 missense possibly damaging 0.82
R1892:Morc2b UTSW 17 33135774 missense probably damaging 1.00
R1954:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1955:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1969:Morc2b UTSW 17 33137091 missense probably benign 0.00
R2069:Morc2b UTSW 17 33136760 missense probably benign 0.13
R3609:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3610:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3831:Morc2b UTSW 17 33137259 missense probably benign 0.01
R4156:Morc2b UTSW 17 33138427 missense probably benign 0.43
R4243:Morc2b UTSW 17 33136401 missense probably benign 0.03
R4877:Morc2b UTSW 17 33138738 missense probably benign 0.26
R4911:Morc2b UTSW 17 33137377 missense probably damaging 1.00
R5230:Morc2b UTSW 17 33136252 missense probably benign 0.00
R5264:Morc2b UTSW 17 33138379 missense probably benign 0.03
R5326:Morc2b UTSW 17 33136933 missense probably benign 0.01
R5455:Morc2b UTSW 17 33138610 missense probably benign 0.29
R5973:Morc2b UTSW 17 33137472 missense probably damaging 0.97
R6026:Morc2b UTSW 17 33137983 missense possibly damaging 0.55
R6113:Morc2b UTSW 17 33138068 nonsense probably null
R6393:Morc2b UTSW 17 33137776 missense probably damaging 0.97
R7066:Morc2b UTSW 17 33136636 missense probably benign 0.00
R7117:Morc2b UTSW 17 33137952 missense probably benign 0.00
R7120:Morc2b UTSW 17 33135813 missense probably damaging 1.00
R7130:Morc2b UTSW 17 33136288 missense possibly damaging 0.68
R7498:Morc2b UTSW 17 33137859 missense possibly damaging 0.55
R7516:Morc2b UTSW 17 33137461 missense probably benign 0.03
R7664:Morc2b UTSW 17 33136402 missense probably benign 0.12
R7754:Morc2b UTSW 17 33137244 missense probably benign 0.33
R7756:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7758:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7766:Morc2b UTSW 17 33138423 missense probably benign 0.19
Z1088:Morc2b UTSW 17 33136086 missense possibly damaging 0.49
Z1177:Morc2b UTSW 17 33137402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCTCATGAAAGGTTCGAGAC -3'
(R):5'- ATTACAGCACTCTCAACCGG -3'

Sequencing Primer
(F):5'- GGCAACTCATGGTGTTTTCTTTC -3'
(R):5'- ACCGGGCTCAACTAACCTTTG -3'
Posted On2017-02-28