Incidental Mutation 'R5934:Abcb4'
ID462089
Institutional Source Beutler Lab
Gene Symbol Abcb4
Ensembl Gene ENSMUSG00000042476
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 4
SynonymsPgy-2, Mdr2, Pgy2, mdr-2
MMRRC Submission 044128-MU
Accession Numbers

Ncbi RefSeq: NM_008830; MGI: 97569

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5934 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8893717-8959231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8930806 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 596 (V596A)
Ref Sequence ENSEMBL: ENSMUSP00000142425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003717] [ENSMUST00000196067]
Predicted Effect probably benign
Transcript: ENSMUST00000003717
AA Change: V596A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000003717
Gene: ENSMUSG00000042476
AA Change: V596A

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 342 2e-94 PFAM
AAA 418 610 3.97e-20 SMART
Pfam:ABC_membrane 708 982 6.3e-77 PFAM
AAA 1058 1246 4.49e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196067
AA Change: V596A

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142425
Gene: ENSMUSG00000042476
AA Change: V596A

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 344 2.4e-95 PFAM
AAA 418 610 6.2e-22 SMART
Pfam:ABC_membrane 708 882 1.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199954
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype Strain: 1857236
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are unable to secrete phospholipids into bile, leading to progressive hepatic disease, with an end stage of 3 months. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg1l G A 10: 42,318,686 T370M probably damaging Het
Aldh2 T C 5: 121,579,615 T118A probably benign Het
Apcdd1 C T 18: 62,951,869 A379V possibly damaging Het
Atp1a3 T C 7: 24,978,874 probably benign Het
Cd96 G T 16: 46,117,903 D66E probably benign Het
Cdh5 T A 8: 104,138,268 V506E probably benign Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Ckb A T 12: 111,670,229 V237D probably damaging Het
Col6a6 C T 9: 105,767,075 D1306N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D1Ertd622e A T 1: 97,645,930 C137S possibly damaging Het
Ddhd2 A G 8: 25,753,113 S19P probably damaging Het
Dnah17 G T 11: 118,041,102 D3681E probably benign Het
Dopey1 T A 9: 86,542,442 Y2068* probably null Het
Fam26e A G 10: 34,092,202 V285A possibly damaging Het
Fryl T C 5: 73,090,717 Y1019C probably damaging Het
Fsip2 G A 2: 82,986,748 C4275Y possibly damaging Het
Gapdh A G 6: 125,162,701 V202A probably damaging Het
Gm8394 T C 10: 85,314,281 noncoding transcript Het
Gmeb2 T C 2: 181,255,574 I250M possibly damaging Het
Gpr88 C T 3: 116,252,309 G118R probably damaging Het
Hdhd3 C A 4: 62,499,370 V190L possibly damaging Het
Heg1 C T 16: 33,726,919 T461M probably damaging Het
Hspg2 A G 4: 137,518,772 Y989C probably damaging Het
Ift74 A T 4: 94,632,734 M175L probably benign Het
Kcnh3 G A 15: 99,226,533 R101Q possibly damaging Het
Kif20b G T 19: 34,941,321 V702F probably benign Het
Klhl1 A G 14: 96,123,215 probably null Het
Lrrk2 T C 15: 91,734,046 V916A probably benign Het
Mpp4 A T 1: 59,121,376 D589E probably damaging Het
Msl2 T C 9: 101,101,818 C464R probably damaging Het
Mucl2 A T 15: 103,897,566 S42T probably benign Het
Musk T A 4: 58,373,613 L838Q probably damaging Het
Nos1 A G 5: 117,936,445 H1052R probably damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr1420 A G 19: 11,896,929 R303G probably benign Het
Olfr352 T A 2: 36,870,268 I234N probably benign Het
Olfr463 T C 11: 87,893,223 R234G possibly damaging Het
Olfr52 T A 2: 86,182,102 Q3L probably benign Het
Olfr521 A T 7: 99,767,389 I76F probably damaging Het
Olfr672 C A 7: 104,996,178 C242F probably damaging Het
Olfr683 G A 7: 105,143,660 S211F probably benign Het
Olfr960 C T 9: 39,623,183 T20I probably damaging Het
Pard3 T G 8: 127,389,338 L636R probably damaging Het
Pigr A T 1: 130,844,527 S161C probably damaging Het
Polr1e T C 4: 45,029,369 S325P probably damaging Het
Prrc2a A T 17: 35,150,084 V1992E probably damaging Het
Ptpdc1 T C 13: 48,586,369 K468E probably benign Het
Rab22a A G 2: 173,661,504 T37A probably damaging Het
Rai14 T A 15: 10,575,159 K571I probably damaging Het
Reck G A 4: 43,930,979 G660D probably damaging Het
Rgs4 T C 1: 169,745,238 D43G possibly damaging Het
Ryr2 A T 13: 11,584,154 D4645E probably damaging Het
Sf3b3 A G 8: 110,823,470 S639P probably damaging Het
Slc27a4 G T 2: 29,811,660 R430L probably damaging Het
Slfn1 T A 11: 83,121,944 Y295* probably null Het
Slfn5 C T 11: 82,956,592 S101L probably damaging Het
Sult1d1 CCATG CCATGGCATG 5: 87,559,770 probably null Het
Tchh A T 3: 93,444,112 Q286H unknown Het
Tmem184c A T 8: 77,604,723 Y172* probably null Het
Tsc22d1 T G 14: 76,418,826 M833R possibly damaging Het
Ugt1a7c G T 1: 88,095,879 L253F probably damaging Het
Usp19 C T 9: 108,492,567 probably benign Het
Xirp2 T A 2: 67,524,804 I3303K possibly damaging Het
Zfp574 G A 7: 25,080,332 A260T probably benign Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Abcb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Abcb4 APN 5 8950073 missense probably benign 0.02
IGL00663:Abcb4 APN 5 8927916 missense probably damaging 1.00
IGL00671:Abcb4 APN 5 8930745 nonsense probably null
IGL00822:Abcb4 APN 5 8950046 missense probably benign
IGL01080:Abcb4 APN 5 8934258 missense probably damaging 1.00
IGL01152:Abcb4 APN 5 8950678 missense probably benign 0.19
IGL01329:Abcb4 APN 5 8894166 critical splice donor site probably null
IGL01483:Abcb4 APN 5 8927871 missense probably damaging 0.99
IGL01594:Abcb4 APN 5 8946071 unclassified probably null
IGL01785:Abcb4 APN 5 8915058 nonsense probably null
IGL01968:Abcb4 APN 5 8927913 missense probably benign 0.33
IGL02579:Abcb4 APN 5 8955537 missense probably damaging 1.00
IGL02654:Abcb4 APN 5 8927826 missense possibly damaging 0.80
IGL02658:Abcb4 APN 5 8934240 missense probably benign
IGL03229:Abcb4 APN 5 8940936 missense probably damaging 0.97
IGL03335:Abcb4 APN 5 8935258 missense probably benign 0.00
FR4737:Abcb4 UTSW 5 8896597 small deletion probably benign
P0014:Abcb4 UTSW 5 8950083 missense probably benign 0.01
R0102:Abcb4 UTSW 5 8909194 missense probably damaging 0.99
R0102:Abcb4 UTSW 5 8909194 missense probably damaging 0.99
R0309:Abcb4 UTSW 5 8939835 missense probably damaging 1.00
R0311:Abcb4 UTSW 5 8934243 missense probably benign
R0420:Abcb4 UTSW 5 8941050 missense probably benign 0.03
R0449:Abcb4 UTSW 5 8939885 nonsense probably null
R0609:Abcb4 UTSW 5 8947376 missense probably damaging 0.96
R1459:Abcb4 UTSW 5 8918662 missense possibly damaging 0.61
R1470:Abcb4 UTSW 5 8940968 missense probably damaging 0.98
R1470:Abcb4 UTSW 5 8940968 missense probably damaging 0.98
R1812:Abcb4 UTSW 5 8928578 critical splice donor site probably null
R1944:Abcb4 UTSW 5 8930796 missense probably damaging 1.00
R2002:Abcb4 UTSW 5 8905989 missense probably benign 0.01
R2256:Abcb4 UTSW 5 8958431 missense probably damaging 1.00
R3116:Abcb4 UTSW 5 8896610 missense possibly damaging 0.86
R4112:Abcb4 UTSW 5 8936783 critical splice acceptor site probably null
R4354:Abcb4 UTSW 5 8918771 missense probably benign 0.44
R4512:Abcb4 UTSW 5 8928573 missense probably damaging 1.00
R4588:Abcb4 UTSW 5 8947328 missense probably benign 0.01
R4628:Abcb4 UTSW 5 8907399 missense probably benign 0.08
R4708:Abcb4 UTSW 5 8915125 missense possibly damaging 0.90
R4714:Abcb4 UTSW 5 8930906 splice site probably null
R4754:Abcb4 UTSW 5 8910717 missense probably damaging 1.00
R4846:Abcb4 UTSW 5 8935180 missense probably benign
R4896:Abcb4 UTSW 5 8907267 missense possibly damaging 0.81
R4944:Abcb4 UTSW 5 8934327 critical splice donor site probably null
R4994:Abcb4 UTSW 5 8928524 missense probably damaging 1.00
R5022:Abcb4 UTSW 5 8909054 intron probably null
R5537:Abcb4 UTSW 5 8955485 missense probably damaging 0.98
R5754:Abcb4 UTSW 5 8934320 missense probably benign
R5833:Abcb4 UTSW 5 8958314 missense probably damaging 1.00
R6006:Abcb4 UTSW 5 8946026 missense probably damaging 0.99
R6146:Abcb4 UTSW 5 8896587 missense probably benign 0.05
R6183:Abcb4 UTSW 5 8918718 missense probably benign
R6260:Abcb4 UTSW 5 8934219 nonsense probably null
R6561:Abcb4 UTSW 5 8927825 missense probably benign 0.14
R7016:Abcb4 UTSW 5 8936843 missense probably benign 0.35
R7081:Abcb4 UTSW 5 8934263 missense probably benign
R7326:Abcb4 UTSW 5 8934226 missense probably benign 0.00
R7375:Abcb4 UTSW 5 8918671 missense probably benign
R7787:Abcb4 UTSW 5 8909220 missense probably damaging 1.00
R7836:Abcb4 UTSW 5 8934203 missense probably benign
R7919:Abcb4 UTSW 5 8934203 missense probably benign
RF015:Abcb4 UTSW 5 8896594 frame shift probably null
RF047:Abcb4 UTSW 5 8896595 frame shift probably null
Z1176:Abcb4 UTSW 5 8959005
Z1177:Abcb4 UTSW 5 8939906
Predicted Primers PCR Primer
(F):5'- GGAGTGTCACTTTCTCACCG -3'
(R):5'- AATGCCTCATCCTAGTCATGGTTTC -3'

Sequencing Primer
(F):5'- TCACCGCTGCTTGCAAG -3'
(R):5'- ATGGTTTCTTTGTATACCATCAGCTG -3'
Posted On2017-02-28