Incidental Mutation 'R0567:C1galt1'
ID46209
Institutional Source Beutler Lab
Gene Symbol C1galt1
Ensembl Gene ENSMUSG00000042460
Gene Namecore 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
SynonymsT-synthase, core 1 beta3-Gal-T, 2210410E06Rik
MMRRC Submission 038758-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0567 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location7844842-7875687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7866874 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 240 (D240G)
Ref Sequence ENSEMBL: ENSMUSP00000047931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040159]
Predicted Effect probably damaging
Transcript: ENSMUST00000040159
AA Change: D240G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047931
Gene: ENSMUSG00000042460
AA Change: D240G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Fringe 83 283 3e-18 PFAM
Pfam:Galactosyl_T 108 258 6.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203898
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene generates the common core 1 O-glycan structure, Gal-beta-1-3GalNAc-R, by the transfer of Gal from UDP-Gal to GalNAc-alpha-1-R. Core 1 is a precursor for many extended mucin-type O-glycans on cell surface and secreted glycoproteins. Studies in mice suggest that this gene plays a key role in thrombopoiesis and kidney homeostasis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Embryos homozygous for a null allele show impaired angiogenesis, chaotic microvascular networks in brain, and fatal hemorrhage by E14. Eggs homozygous for another null allele show a slightly thinner zona pellucida. Mice homozygous for an ENU-induced allele develop thrombocytopenia and renal disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,228,016 E303G probably damaging Het
Akr1b3 A T 6: 34,304,345 probably null Het
Alox8 A T 11: 69,191,522 probably null Het
Apcdd1 G A 18: 62,934,036 E74K possibly damaging Het
Atr T C 9: 95,865,829 V388A probably benign Het
AW554918 G A 18: 25,400,035 E452K possibly damaging Het
Ccdc130 A G 8: 84,260,665 L93P probably damaging Het
Ceacam10 T A 7: 24,778,409 D116E probably damaging Het
Col15a1 G T 4: 47,293,231 V912L possibly damaging Het
Cyp3a11 G A 5: 145,869,149 T136I probably damaging Het
Denr C T 5: 123,908,158 T17M probably benign Het
Doc2b A G 11: 75,780,124 F227S probably damaging Het
Dsp A T 13: 38,192,438 T1400S probably benign Het
Egfr A T 11: 16,872,873 D412V probably benign Het
Fryl C T 5: 73,065,391 G1949D possibly damaging Het
Gstp3 A T 19: 4,057,636 L176Q possibly damaging Het
Heatr5a T A 12: 51,910,089 N1075I probably damaging Het
Hist1h2ah T C 13: 22,035,564 probably benign Het
Ighv1-69 C T 12: 115,623,549 probably benign Het
Lama3 A G 18: 12,549,252 I1092V probably benign Het
Lipg A T 18: 74,957,369 H36Q probably benign Het
Myh7b T C 2: 155,626,398 W836R probably damaging Het
Oit3 A T 10: 59,435,978 C186S probably damaging Het
Olfr734 A T 14: 50,320,658 M59K probably damaging Het
P2ry2 T C 7: 100,998,541 T186A probably damaging Het
Pyroxd2 T C 19: 42,735,925 T300A probably benign Het
Rab26 C A 17: 24,529,582 V283F probably damaging Het
Rad50 C T 11: 53,654,956 R1180Q probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Shroom3 A G 5: 92,964,453 D1891G possibly damaging Het
Syne2 G A 12: 75,890,230 E201K probably damaging Het
Taf6 A T 5: 138,183,726 probably null Het
Tbc1d32 A T 10: 56,173,963 M493K possibly damaging Het
Uaca A G 9: 60,871,381 T1017A probably benign Het
Usp17le C T 7: 104,768,898 V346I possibly damaging Het
Vmn1r71 T C 7: 10,748,629 D44G probably damaging Het
Vmn2r80 A G 10: 79,194,831 I830M possibly damaging Het
Zfp994 T C 17: 22,200,468 Y500C possibly damaging Het
Zscan20 A G 4: 128,589,450 probably null Het
Other mutations in C1galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:C1galt1 APN 6 7866475 missense probably damaging 0.98
PIT4378001:C1galt1 UTSW 6 7863944 missense probably benign 0.01
R0086:C1galt1 UTSW 6 7867051 splice site probably benign
R0540:C1galt1 UTSW 6 7871193 missense probably benign 0.00
R0607:C1galt1 UTSW 6 7871193 missense probably benign 0.00
R1519:C1galt1 UTSW 6 7866402 missense probably damaging 0.99
R1712:C1galt1 UTSW 6 7871217 missense probably benign
R2989:C1galt1 UTSW 6 7866622 missense possibly damaging 0.50
R3035:C1galt1 UTSW 6 7866762 missense probably benign 0.06
R4271:C1galt1 UTSW 6 7866607 missense probably damaging 1.00
R4749:C1galt1 UTSW 6 7866379 missense probably benign 0.42
R5029:C1galt1 UTSW 6 7863931 missense possibly damaging 0.95
R5393:C1galt1 UTSW 6 7864143 critical splice donor site probably null
R5448:C1galt1 UTSW 6 7866658 missense possibly damaging 0.95
R7055:C1galt1 UTSW 6 7866585 missense probably damaging 1.00
R7319:C1galt1 UTSW 6 7871150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAACAACCCATTTACTTTGGGCG -3'
(R):5'- CATGACCCACAGGTTTAGAGCACC -3'

Sequencing Primer
(F):5'- GCGAAGATTTAAGCCCTATGTG -3'
(R):5'- GCTGTGTTACACTGTCAGTACATAC -3'
Posted On2013-06-11