Incidental Mutation 'R5934:Fryl'
ID462091
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene NameFRY like transcription coactivator
Synonyms2510002A14Rik, 2310004H21Rik, 9030227G01Rik
MMRRC Submission 044128-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R5934 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73019987-73256619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73090717 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1019 (Y1019C)
Ref Sequence ENSEMBL: ENSMUSP00000098687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
Predicted Effect probably damaging
Transcript: ENSMUST00000094700
AA Change: Y1019C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: Y1019C

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101127
AA Change: Y1019C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: Y1019C

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202381
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,930,806 V596A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg1l G A 10: 42,318,686 T370M probably damaging Het
Aldh2 T C 5: 121,579,615 T118A probably benign Het
Apcdd1 C T 18: 62,951,869 A379V possibly damaging Het
Atp1a3 T C 7: 24,978,874 probably benign Het
Cd96 G T 16: 46,117,903 D66E probably benign Het
Cdh5 T A 8: 104,138,268 V506E probably benign Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Ckb A T 12: 111,670,229 V237D probably damaging Het
Col6a6 C T 9: 105,767,075 D1306N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D1Ertd622e A T 1: 97,645,930 C137S possibly damaging Het
Ddhd2 A G 8: 25,753,113 S19P probably damaging Het
Dnah17 G T 11: 118,041,102 D3681E probably benign Het
Dopey1 T A 9: 86,542,442 Y2068* probably null Het
Fam26e A G 10: 34,092,202 V285A possibly damaging Het
Fsip2 G A 2: 82,986,748 C4275Y possibly damaging Het
Gapdh A G 6: 125,162,701 V202A probably damaging Het
Gm8394 T C 10: 85,314,281 noncoding transcript Het
Gmeb2 T C 2: 181,255,574 I250M possibly damaging Het
Gpr88 C T 3: 116,252,309 G118R probably damaging Het
Hdhd3 C A 4: 62,499,370 V190L possibly damaging Het
Heg1 C T 16: 33,726,919 T461M probably damaging Het
Hspg2 A G 4: 137,518,772 Y989C probably damaging Het
Ift74 A T 4: 94,632,734 M175L probably benign Het
Kcnh3 G A 15: 99,226,533 R101Q possibly damaging Het
Kif20b G T 19: 34,941,321 V702F probably benign Het
Klhl1 A G 14: 96,123,215 probably null Het
Lrrk2 T C 15: 91,734,046 V916A probably benign Het
Mpp4 A T 1: 59,121,376 D589E probably damaging Het
Msl2 T C 9: 101,101,818 C464R probably damaging Het
Mucl2 A T 15: 103,897,566 S42T probably benign Het
Musk T A 4: 58,373,613 L838Q probably damaging Het
Nos1 A G 5: 117,936,445 H1052R probably damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr1420 A G 19: 11,896,929 R303G probably benign Het
Olfr352 T A 2: 36,870,268 I234N probably benign Het
Olfr463 T C 11: 87,893,223 R234G possibly damaging Het
Olfr52 T A 2: 86,182,102 Q3L probably benign Het
Olfr521 A T 7: 99,767,389 I76F probably damaging Het
Olfr672 C A 7: 104,996,178 C242F probably damaging Het
Olfr683 G A 7: 105,143,660 S211F probably benign Het
Olfr960 C T 9: 39,623,183 T20I probably damaging Het
Pard3 T G 8: 127,389,338 L636R probably damaging Het
Pigr A T 1: 130,844,527 S161C probably damaging Het
Polr1e T C 4: 45,029,369 S325P probably damaging Het
Prrc2a A T 17: 35,150,084 V1992E probably damaging Het
Ptpdc1 T C 13: 48,586,369 K468E probably benign Het
Rab22a A G 2: 173,661,504 T37A probably damaging Het
Rai14 T A 15: 10,575,159 K571I probably damaging Het
Reck G A 4: 43,930,979 G660D probably damaging Het
Rgs4 T C 1: 169,745,238 D43G possibly damaging Het
Ryr2 A T 13: 11,584,154 D4645E probably damaging Het
Sf3b3 A G 8: 110,823,470 S639P probably damaging Het
Slc27a4 G T 2: 29,811,660 R430L probably damaging Het
Slfn1 T A 11: 83,121,944 Y295* probably null Het
Slfn5 C T 11: 82,956,592 S101L probably damaging Het
Sult1d1 CCATG CCATGGCATG 5: 87,559,770 probably null Het
Tchh A T 3: 93,444,112 Q286H unknown Het
Tmem184c A T 8: 77,604,723 Y172* probably null Het
Tsc22d1 T G 14: 76,418,826 M833R possibly damaging Het
Ugt1a7c G T 1: 88,095,879 L253F probably damaging Het
Usp19 C T 9: 108,492,567 probably benign Het
Xirp2 T A 2: 67,524,804 I3303K possibly damaging Het
Zfp574 G A 7: 25,080,332 A260T probably benign Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
bedeviled UTSW 5 73059500 missense probably damaging 1.00
Besotted UTSW 5 73072912 missense probably damaging 1.00
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0312:Fryl UTSW 5 73072888 missense probably damaging 1.00
R0415:Fryl UTSW 5 73098414 missense probably damaging 0.99
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0833:Fryl UTSW 5 73089081 unclassified probably benign
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R1994:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4664:Fryl UTSW 5 73090679 missense possibly damaging 0.80
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5072:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5778:Fryl UTSW 5 73072778 missense probably damaging 1.00
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6185:Fryl UTSW 5 73112788 missense probably benign 0.43
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6823:Fryl UTSW 5 73065217 missense probably damaging 0.99
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
R6980:Fryl UTSW 5 73050430 missense probably benign 0.06
R7036:Fryl UTSW 5 73055608 missense probably benign 0.03
R7065:Fryl UTSW 5 73090756 missense probably damaging 0.96
R7097:Fryl UTSW 5 73073908 missense probably benign 0.31
R7171:Fryl UTSW 5 73122310 missense probably damaging 0.97
R7191:Fryl UTSW 5 73072912 missense probably damaging 1.00
R7207:Fryl UTSW 5 73065095 missense probably benign
R7236:Fryl UTSW 5 73108478 missense possibly damaging 0.66
R7334:Fryl UTSW 5 73047496 intron probably null
R7425:Fryl UTSW 5 73104748 missense probably damaging 1.00
R7452:Fryl UTSW 5 73023988 missense probably damaging 1.00
R7479:Fryl UTSW 5 73097561 missense possibly damaging 0.71
R7535:Fryl UTSW 5 73098196 missense probably benign 0.15
R7538:Fryl UTSW 5 73022676 missense probably benign 0.09
R7544:Fryl UTSW 5 73081039 missense probably benign
R7548:Fryl UTSW 5 73191762 missense unknown
R7565:Fryl UTSW 5 73033720 missense probably benign 0.18
R7572:Fryl UTSW 5 73088396 missense possibly damaging 0.91
R7582:Fryl UTSW 5 73022500 critical splice donor site probably null
R7630:Fryl UTSW 5 73110245 missense possibly damaging 0.62
R7774:Fryl UTSW 5 73083384 missense probably benign 0.12
R7777:Fryl UTSW 5 73071298 missense probably damaging 0.98
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTTATTTATGTGCGGGCAC -3'
(R):5'- AAGTGTCATTCTGCCACAAGC -3'

Sequencing Primer
(F):5'- CATGTGTGAACATGCCTCAG -3'
(R):5'- AAGCACACCAGGTTTGCCG -3'
Posted On2017-02-28