Mutagenetix > Incidental Mutations

Incidental Mutation 'R5934:Nos1'

462094

Institutional Source

Beutler Lab

Gene Symbol

Nos1

Ensembl Gene

ENSMUSG00000029361

Gene Name

nitric oxide synthase 1, neuronal

Synonyms

bNOS, nNOS, 2310005C01Rik, Nos-1, NO

MMRRC Submission

044128-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5934 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

117781032-117958840 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 117936445 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1052 (H1052R)

Ref Sequence

ENSEMBL: ENSMUSP00000099617 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086451] [ENSMUST00000102557] [ENSMUST00000142742] [ENSMUST00000171055]

Predicted Effect

probably damaging
Transcript: ENSMUST00000086451
AA Change: H1018R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138506
Gene: ENSMUSG00000029361
AA Change: H1018R

Domain	Start	End	E-Value	Type
PDZ	26	100	2.73e-16	SMART
Pfam:NO_synthase	346	717	1e-226	PFAM
Pfam:Flavodoxin_1	757	930	3.5e-56	PFAM
Pfam:FAD_binding_1	985	1214	1.1e-84	PFAM
Pfam:NAD_binding_1	1246	1360	2.7e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102557
AA Change: H1052R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099617
Gene: ENSMUSG00000029361
AA Change: H1052R

Domain	Start	End	E-Value	Type
PDZ	26	100	2.73e-16	SMART
Pfam:NO_synthase	350	712	2e-196	PFAM
Pfam:Flavodoxin_1	757	964	2.3e-55	PFAM
Pfam:FAD_binding_1	1019	1248	2.9e-88	PFAM
Pfam:NAD_binding_1	1280	1394	2.6e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000142742
AA Change: H1018R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000120421
Gene: ENSMUSG00000029361
AA Change: H1018R

Domain	Start	End	E-Value	Type
PDZ	26	100	2.73e-16	SMART
Pfam:NO_synthase	346	717	4e-226	PFAM
Pfam:Flavodoxin_1	757	930	1.5e-55	PFAM
Pfam:FAD_binding_1	985	1214	3.2e-84	PFAM
Pfam:NAD_binding_1	1246	1360	1.4e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000171055
AA Change: H1018R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000127432
Gene: ENSMUSG00000029361
AA Change: H1018R

Domain	Start	End	E-Value	Type
PDZ	26	100	2.73e-16	SMART
Pfam:NO_synthase	346	717	4e-226	PFAM
Pfam:Flavodoxin_1	757	930	1.5e-55	PFAM
Pfam:FAD_binding_1	985	1214	3.2e-84	PFAM
Pfam:NAD_binding_1	1246	1360	1.4e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182216

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of nitric oxide synthases, which synthesize nitric oxide from L-arginine. Nitric oxide is a reactive free radical, which acts as a biologic mediator in several processes, including neurotransmission, and antimicrobial and antitumoral activities. In the brain and peripheral nervous system, nitric oxide displays many properties of a neurotransmitter, and has been implicated in neurotoxicity associated with stroke and neurodegenerative diseases, neural regulation of smooth muscle, including peristalsis, and penile erection. This protein is ubiquitously expressed, with high level of expression in skeletal muscle. Multiple transcript variants that differ in the 5' UTR have been described for this gene but the full-length nature of these transcripts is not known. Additionally, alternatively spliced transcript variants encoding different isoforms (some testis-specific) have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice exhibit enlarged stomachs, abnormal pyloric and lower esophageal sphincters, age-related cardiac hypertrophy, altered alcohol consumption and responses, decreased ovulation and reduced REM sleep. Homozygous null mice display increased neurogenesis in the adult brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	T	C	5: 8,930,806	V596A	probably benign	Het
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Afg1l	G	A	10: 42,318,686	T370M	probably damaging	Het
Aldh2	T	C	5: 121,579,615	T118A	probably benign	Het
Apcdd1	C	T	18: 62,951,869	A379V	possibly damaging	Het
Atp1a3	T	C	7: 24,978,874		probably benign	Het
Cd96	G	T	16: 46,117,903	D66E	probably benign	Het
Cdh5	T	A	8: 104,138,268	V506E	probably benign	Het
Cep70	T	C	9: 99,254,265	I7T	probably benign	Het
Ckb	A	T	12: 111,670,229	V237D	probably damaging	Het
Col6a6	C	T	9: 105,767,075	D1306N	probably damaging	Het
Cysltr2	T	C	14: 73,029,491	K260E	probably benign	Het
D1Ertd622e	A	T	1: 97,645,930	C137S	possibly damaging	Het
Ddhd2	A	G	8: 25,753,113	S19P	probably damaging	Het
Dnah17	G	T	11: 118,041,102	D3681E	probably benign	Het
Dopey1	T	A	9: 86,542,442	Y2068*	probably null	Het
Fam26e	A	G	10: 34,092,202	V285A	possibly damaging	Het
Fryl	T	C	5: 73,090,717	Y1019C	probably damaging	Het
Fsip2	G	A	2: 82,986,748	C4275Y	possibly damaging	Het
Gapdh	A	G	6: 125,162,701	V202A	probably damaging	Het
Gm8394	T	C	10: 85,314,281		noncoding transcript	Het
Gmeb2	T	C	2: 181,255,574	I250M	possibly damaging	Het
Gpr88	C	T	3: 116,252,309	G118R	probably damaging	Het
Hdhd3	C	A	4: 62,499,370	V190L	possibly damaging	Het
Heg1	C	T	16: 33,726,919	T461M	probably damaging	Het
Hspg2	A	G	4: 137,518,772	Y989C	probably damaging	Het
Ift74	A	T	4: 94,632,734	M175L	probably benign	Het
Kcnh3	G	A	15: 99,226,533	R101Q	possibly damaging	Het
Kif20b	G	T	19: 34,941,321	V702F	probably benign	Het
Klhl1	A	G	14: 96,123,215		probably null	Het
Lrrk2	T	C	15: 91,734,046	V916A	probably benign	Het
Mpp4	A	T	1: 59,121,376	D589E	probably damaging	Het
Msl2	T	C	9: 101,101,818	C464R	probably damaging	Het
Mucl2	A	T	15: 103,897,566	S42T	probably benign	Het
Musk	T	A	4: 58,373,613	L838Q	probably damaging	Het
Olfr1151	T	C	2: 87,857,241	V22A	probably benign	Het
Olfr1420	A	G	19: 11,896,929	R303G	probably benign	Het
Olfr352	T	A	2: 36,870,268	I234N	probably benign	Het
Olfr463	T	C	11: 87,893,223	R234G	possibly damaging	Het
Olfr52	T	A	2: 86,182,102	Q3L	probably benign	Het
Olfr521	A	T	7: 99,767,389	I76F	probably damaging	Het
Olfr672	C	A	7: 104,996,178	C242F	probably damaging	Het
Olfr683	G	A	7: 105,143,660	S211F	probably benign	Het
Olfr960	C	T	9: 39,623,183	T20I	probably damaging	Het
Pard3	T	G	8: 127,389,338	L636R	probably damaging	Het
Pigr	A	T	1: 130,844,527	S161C	probably damaging	Het
Polr1e	T	C	4: 45,029,369	S325P	probably damaging	Het
Prrc2a	A	T	17: 35,150,084	V1992E	probably damaging	Het
Ptpdc1	T	C	13: 48,586,369	K468E	probably benign	Het
Rab22a	A	G	2: 173,661,504	T37A	probably damaging	Het
Rai14	T	A	15: 10,575,159	K571I	probably damaging	Het
Reck	G	A	4: 43,930,979	G660D	probably damaging	Het
Rgs4	T	C	1: 169,745,238	D43G	possibly damaging	Het
Ryr2	A	T	13: 11,584,154	D4645E	probably damaging	Het
Sf3b3	A	G	8: 110,823,470	S639P	probably damaging	Het
Slc27a4	G	T	2: 29,811,660	R430L	probably damaging	Het
Slfn1	T	A	11: 83,121,944	Y295*	probably null	Het
Slfn5	C	T	11: 82,956,592	S101L	probably damaging	Het
Sult1d1	CCATG	CCATGGCATG	5: 87,559,770		probably null	Het
Tchh	A	T	3: 93,444,112	Q286H	unknown	Het
Tmem184c	A	T	8: 77,604,723	Y172*	probably null	Het
Tsc22d1	T	G	14: 76,418,826	M833R	possibly damaging	Het
Ugt1a7c	G	T	1: 88,095,879	L253F	probably damaging	Het
Usp19	C	T	9: 108,492,567		probably benign	Het
Xirp2	T	A	2: 67,524,804	I3303K	possibly damaging	Het
Zfp574	G	A	7: 25,080,332	A260T	probably benign	Het
Zswim6	A	G	13: 107,744,107		noncoding transcript	Het

Other mutations in Nos1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Nos1	APN	5	117910100	missense	probably damaging	0.99
IGL01155:Nos1	APN	5	117945926	missense	probably damaging	0.99
IGL01462:Nos1	APN	5	117867709	missense	probably benign	0.10
IGL01464:Nos1	APN	5	117943192	missense	probably damaging	1.00
IGL01620:Nos1	APN	5	117905309	critical splice acceptor site	probably null
IGL01621:Nos1	APN	5	117945884	missense	probably damaging	1.00
IGL01796:Nos1	APN	5	117938274	nonsense	probably null
IGL02003:Nos1	APN	5	117905465	missense	probably damaging	1.00
IGL02274:Nos1	APN	5	117897780	missense	probably damaging	1.00
IGL02885:Nos1	APN	5	117895790	missense	probably damaging	1.00
IGL02947:Nos1	APN	5	117943317	missense	probably damaging	0.99
IGL03088:Nos1	APN	5	117867258	missense	probably damaging	1.00
IGL03166:Nos1	APN	5	117914452	splice site	probably benign
squanderer	UTSW	5	117910238	missense	probably damaging	0.97
R0007:Nos1	UTSW	5	117910088	missense	probably damaging	1.00
R0012:Nos1	UTSW	5	117893902	missense	probably damaging	1.00
R0080:Nos1	UTSW	5	117893878	missense	probably damaging	1.00
R0212:Nos1	UTSW	5	117910212	missense	possibly damaging	0.57
R0240:Nos1	UTSW	5	117867883	missense	probably benign
R0240:Nos1	UTSW	5	117867883	missense	probably benign
R0454:Nos1	UTSW	5	117943320	missense	probably benign	0.00
R0494:Nos1	UTSW	5	117905474	missense	probably damaging	1.00
R0882:Nos1	UTSW	5	117947447	missense	probably damaging	1.00
R1099:Nos1	UTSW	5	117923395	missense	probably damaging	0.96
R1243:Nos1	UTSW	5	117905472	missense	probably damaging	1.00
R1387:Nos1	UTSW	5	117953783	splice site	probably benign
R1432:Nos1	UTSW	5	117949619	splice site	probably benign
R1698:Nos1	UTSW	5	117867232	missense	probably benign	0.01
R1710:Nos1	UTSW	5	117895919	missense	probably damaging	1.00
R1859:Nos1	UTSW	5	117905462	missense	possibly damaging	0.83
R1973:Nos1	UTSW	5	117936426	missense	possibly damaging	0.52
R2084:Nos1	UTSW	5	117943245	missense	probably damaging	1.00
R2112:Nos1	UTSW	5	117936571	missense	probably benign	0.00
R4689:Nos1	UTSW	5	117879385	missense	probably benign	0.04
R4769:Nos1	UTSW	5	117943245	nonsense	probably null
R4893:Nos1	UTSW	5	117952877	missense	possibly damaging	0.50
R4916:Nos1	UTSW	5	117947570	critical splice donor site	probably null
R4956:Nos1	UTSW	5	117947510	missense	probably benign
R4971:Nos1	UTSW	5	117943834	missense	probably benign	0.05
R4987:Nos1	UTSW	5	117926533	critical splice donor site	probably null
R5015:Nos1	UTSW	5	117867269	missense	probably damaging	1.00
R5031:Nos1	UTSW	5	117879313	missense	probably benign
R5137:Nos1	UTSW	5	117905313	missense	probably benign	0.29
R5481:Nos1	UTSW	5	117867754	missense	probably benign	0.06
R5541:Nos1	UTSW	5	117905394	missense	probably damaging	1.00
R5655:Nos1	UTSW	5	117923257	missense	probably damaging	1.00
R5866:Nos1	UTSW	5	117895902	missense	probably damaging	0.97
R6158:Nos1	UTSW	5	117867574	missense	probably benign	0.05
R6225:Nos1	UTSW	5	117912852	missense	probably damaging	1.00
R6261:Nos1	UTSW	5	117936570	missense	probably benign
R6388:Nos1	UTSW	5	117914436	missense	possibly damaging	0.91
R6987:Nos1	UTSW	5	117895785	missense	probably benign	0.05
R7104:Nos1	UTSW	5	117947431	missense	probably damaging	1.00
R7136:Nos1	UTSW	5	117895860	missense	possibly damaging	0.95
R7276:Nos1	UTSW	5	117910238	missense	probably damaging	0.97
R7299:Nos1	UTSW	5	117867905	missense	possibly damaging	0.89
R7301:Nos1	UTSW	5	117867905	missense	possibly damaging	0.89
R7402:Nos1	UTSW	5	117949815	missense	probably benign	0.34
R7408:Nos1	UTSW	5	117867518	missense	probably damaging	1.00
R7618:Nos1	UTSW	5	117903944	missense	probably benign	0.01
R7689:Nos1	UTSW	5	117897727	missense	probably damaging	0.98
X0025:Nos1	UTSW	5	117943825	missense	probably benign	0.00
X0026:Nos1	UTSW	5	117943152	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATGATGGAGAGCTGACTG -3'
(R):5'- TGCAGCTAGAAGCCTTACCC -3'

Sequencing Primer
(F):5'- CTGACTGGAGGAGCTTGGCAG -3'
(R):5'- AAGCCTTACCCAGAGCCGTG -3'

Posted On

2017-02-28