Incidental Mutation 'R5934:Aldh2'
ID462095
Institutional Source Beutler Lab
Gene Symbol Aldh2
Ensembl Gene ENSMUSG00000029455
Gene Namealdehyde dehydrogenase 2, mitochondrial
SynonymsAhd5, Ahd-5
MMRRC Submission 044128-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5934 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121566027-121593824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121579615 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 118 (T118A)
Ref Sequence ENSEMBL: ENSMUSP00000123545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031411] [ENSMUST00000129753] [ENSMUST00000152945] [ENSMUST00000199369]
Predicted Effect probably benign
Transcript: ENSMUST00000031411
AA Change: T119A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031411
Gene: ENSMUSG00000029455
AA Change: T119A

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 510 2.9e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129753
AA Change: T119A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142906
Gene: ENSMUSG00000029455
AA Change: T119A

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 471 1e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133033
Predicted Effect probably benign
Transcript: ENSMUST00000152945
AA Change: T118A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123545
Gene: ENSMUSG00000029455
AA Change: T118A

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 185 1.8e-38 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000199369
AA Change: T18A
SMART Domains Protein: ENSMUSP00000143261
Gene: ENSMUSG00000029455
AA Change: T18A

DomainStartEndE-ValueType
Pfam:Aldedh 1 129 4.2e-43 PFAM
Pfam:Aldedh 125 220 3.6e-36 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. Two major liver isoforms of aldehyde dehydrogenase, cytosolic and mitochondrial, can be distinguished by their electrophoretic mobilities, kinetic properties, and subcellular localizations. Most Caucasians have two major isozymes, while approximately 50% of East Asians have the cytosolic isozyme but not the mitochondrial isozyme. A remarkably higher frequency of acute alcohol intoxication among East Asians than among Caucasians could be related to the absence of a catalytically active form of the mitochondrial isozyme. The increased exposure to acetaldehyde in individuals with the catalytically inactive form may also confer greater susceptibility to many types of cancer. This gene encodes a mitochondrial isoform, which has a low Km for acetaldehydes, and is localized in mitochondrial matrix. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutation of this gene results in the absence of oxidation activity in the mitochondria. Mice homozygous for a different allele exhibit decreased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,930,806 V596A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg1l G A 10: 42,318,686 T370M probably damaging Het
Apcdd1 C T 18: 62,951,869 A379V possibly damaging Het
Atp1a3 T C 7: 24,978,874 probably benign Het
Cd96 G T 16: 46,117,903 D66E probably benign Het
Cdh5 T A 8: 104,138,268 V506E probably benign Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Ckb A T 12: 111,670,229 V237D probably damaging Het
Col6a6 C T 9: 105,767,075 D1306N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D1Ertd622e A T 1: 97,645,930 C137S possibly damaging Het
Ddhd2 A G 8: 25,753,113 S19P probably damaging Het
Dnah17 G T 11: 118,041,102 D3681E probably benign Het
Dopey1 T A 9: 86,542,442 Y2068* probably null Het
Fam26e A G 10: 34,092,202 V285A possibly damaging Het
Fryl T C 5: 73,090,717 Y1019C probably damaging Het
Fsip2 G A 2: 82,986,748 C4275Y possibly damaging Het
Gapdh A G 6: 125,162,701 V202A probably damaging Het
Gm8394 T C 10: 85,314,281 noncoding transcript Het
Gmeb2 T C 2: 181,255,574 I250M possibly damaging Het
Gpr88 C T 3: 116,252,309 G118R probably damaging Het
Hdhd3 C A 4: 62,499,370 V190L possibly damaging Het
Heg1 C T 16: 33,726,919 T461M probably damaging Het
Hspg2 A G 4: 137,518,772 Y989C probably damaging Het
Ift74 A T 4: 94,632,734 M175L probably benign Het
Kcnh3 G A 15: 99,226,533 R101Q possibly damaging Het
Kif20b G T 19: 34,941,321 V702F probably benign Het
Klhl1 A G 14: 96,123,215 probably null Het
Lrrk2 T C 15: 91,734,046 V916A probably benign Het
Mpp4 A T 1: 59,121,376 D589E probably damaging Het
Msl2 T C 9: 101,101,818 C464R probably damaging Het
Mucl2 A T 15: 103,897,566 S42T probably benign Het
Musk T A 4: 58,373,613 L838Q probably damaging Het
Nos1 A G 5: 117,936,445 H1052R probably damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr1420 A G 19: 11,896,929 R303G probably benign Het
Olfr352 T A 2: 36,870,268 I234N probably benign Het
Olfr463 T C 11: 87,893,223 R234G possibly damaging Het
Olfr52 T A 2: 86,182,102 Q3L probably benign Het
Olfr521 A T 7: 99,767,389 I76F probably damaging Het
Olfr672 C A 7: 104,996,178 C242F probably damaging Het
Olfr683 G A 7: 105,143,660 S211F probably benign Het
Olfr960 C T 9: 39,623,183 T20I probably damaging Het
Pard3 T G 8: 127,389,338 L636R probably damaging Het
Pigr A T 1: 130,844,527 S161C probably damaging Het
Polr1e T C 4: 45,029,369 S325P probably damaging Het
Prrc2a A T 17: 35,150,084 V1992E probably damaging Het
Ptpdc1 T C 13: 48,586,369 K468E probably benign Het
Rab22a A G 2: 173,661,504 T37A probably damaging Het
Rai14 T A 15: 10,575,159 K571I probably damaging Het
Reck G A 4: 43,930,979 G660D probably damaging Het
Rgs4 T C 1: 169,745,238 D43G possibly damaging Het
Ryr2 A T 13: 11,584,154 D4645E probably damaging Het
Sf3b3 A G 8: 110,823,470 S639P probably damaging Het
Slc27a4 G T 2: 29,811,660 R430L probably damaging Het
Slfn1 T A 11: 83,121,944 Y295* probably null Het
Slfn5 C T 11: 82,956,592 S101L probably damaging Het
Sult1d1 CCATG CCATGGCATG 5: 87,559,770 probably null Het
Tchh A T 3: 93,444,112 Q286H unknown Het
Tmem184c A T 8: 77,604,723 Y172* probably null Het
Tsc22d1 T G 14: 76,418,826 M833R possibly damaging Het
Ugt1a7c G T 1: 88,095,879 L253F probably damaging Het
Usp19 C T 9: 108,492,567 probably benign Het
Xirp2 T A 2: 67,524,804 I3303K possibly damaging Het
Zfp574 G A 7: 25,080,332 A260T probably benign Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Aldh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Aldh2 APN 5 121572073 missense probably benign 0.00
IGL02145:Aldh2 APN 5 121567993 makesense probably null
IGL02352:Aldh2 APN 5 121575897 missense probably null 1.00
IGL02359:Aldh2 APN 5 121575897 missense probably null 1.00
IGL02473:Aldh2 APN 5 121572078 missense probably damaging 1.00
IGL02818:Aldh2 APN 5 121575125 missense probably benign
IGL03182:Aldh2 APN 5 121580724 unclassified probably benign
IGL03324:Aldh2 APN 5 121575125 missense probably benign
Flushed UTSW 5 121572816 nonsense probably null
R0595:Aldh2 UTSW 5 121573500 missense probably damaging 0.99
R0595:Aldh2 UTSW 5 121573501 missense probably damaging 0.97
R1697:Aldh2 UTSW 5 121578341 critical splice donor site probably null
R1992:Aldh2 UTSW 5 121575963 missense possibly damaging 0.93
R2174:Aldh2 UTSW 5 121572668 intron probably benign
R4786:Aldh2 UTSW 5 121572824 missense probably benign 0.21
R4793:Aldh2 UTSW 5 121568979 missense probably damaging 0.99
R5408:Aldh2 UTSW 5 121570557 intron probably benign
R6266:Aldh2 UTSW 5 121568934 missense probably damaging 0.97
R6294:Aldh2 UTSW 5 121572816 nonsense probably null
R6792:Aldh2 UTSW 5 121580649 missense probably damaging 0.98
R7659:Aldh2 UTSW 5 121568960 missense probably damaging 1.00
X0009:Aldh2 UTSW 5 121572774 missense possibly damaging 0.94
X0027:Aldh2 UTSW 5 121593462 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGACACGGAGATCTTAGCTGG -3'
(R):5'- ACTGTCCCATGCAGTGCTTG -3'

Sequencing Primer
(F):5'- ACACGGAGATCTTAGCTGGTTAGG -3'
(R):5'- GACTGGGAGGCATTCACTG -3'
Posted On2017-02-28