Incidental Mutation 'R5934:Tmem184c'
ID462106
Institutional Source Beutler Lab
Gene Symbol Tmem184c
Ensembl Gene ENSMUSG00000031617
Gene Nametransmembrane protein 184C
SynonymsTmem34, 8430433H16Rik
MMRRC Submission 044128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R5934 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location77595982-77610698 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 77604723 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 172 (Y172*)
Ref Sequence ENSEMBL: ENSMUSP00000114463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034030] [ENSMUST00000141202] [ENSMUST00000152168]
Predicted Effect probably null
Transcript: ENSMUST00000034030
AA Change: Y132*
SMART Domains Protein: ENSMUSP00000034030
Gene: ENSMUSG00000031617
AA Change: Y132*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Solute_trans_a 48 317 1.9e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
internal_repeat_1 422 485 1.18e-11 PROSPERO
low complexity region 500 512 N/A INTRINSIC
internal_repeat_1 519 599 1.18e-11 PROSPERO
low complexity region 600 621 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141202
SMART Domains Protein: ENSMUSP00000120041
Gene: ENSMUSG00000031617

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000152168
AA Change: Y172*
SMART Domains Protein: ENSMUSP00000114463
Gene: ENSMUSG00000031617
AA Change: Y172*

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
Pfam:Solute_trans_a 85 228 1.4e-49 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,930,806 V596A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg1l G A 10: 42,318,686 T370M probably damaging Het
Aldh2 T C 5: 121,579,615 T118A probably benign Het
Apcdd1 C T 18: 62,951,869 A379V possibly damaging Het
Atp1a3 T C 7: 24,978,874 probably benign Het
Cd96 G T 16: 46,117,903 D66E probably benign Het
Cdh5 T A 8: 104,138,268 V506E probably benign Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Ckb A T 12: 111,670,229 V237D probably damaging Het
Col6a6 C T 9: 105,767,075 D1306N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D1Ertd622e A T 1: 97,645,930 C137S possibly damaging Het
Ddhd2 A G 8: 25,753,113 S19P probably damaging Het
Dnah17 G T 11: 118,041,102 D3681E probably benign Het
Dopey1 T A 9: 86,542,442 Y2068* probably null Het
Fam26e A G 10: 34,092,202 V285A possibly damaging Het
Fryl T C 5: 73,090,717 Y1019C probably damaging Het
Fsip2 G A 2: 82,986,748 C4275Y possibly damaging Het
Gapdh A G 6: 125,162,701 V202A probably damaging Het
Gm8394 T C 10: 85,314,281 noncoding transcript Het
Gmeb2 T C 2: 181,255,574 I250M possibly damaging Het
Gpr88 C T 3: 116,252,309 G118R probably damaging Het
Hdhd3 C A 4: 62,499,370 V190L possibly damaging Het
Heg1 C T 16: 33,726,919 T461M probably damaging Het
Hspg2 A G 4: 137,518,772 Y989C probably damaging Het
Ift74 A T 4: 94,632,734 M175L probably benign Het
Kcnh3 G A 15: 99,226,533 R101Q possibly damaging Het
Kif20b G T 19: 34,941,321 V702F probably benign Het
Klhl1 A G 14: 96,123,215 probably null Het
Lrrk2 T C 15: 91,734,046 V916A probably benign Het
Mpp4 A T 1: 59,121,376 D589E probably damaging Het
Msl2 T C 9: 101,101,818 C464R probably damaging Het
Mucl2 A T 15: 103,897,566 S42T probably benign Het
Musk T A 4: 58,373,613 L838Q probably damaging Het
Nos1 A G 5: 117,936,445 H1052R probably damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr1420 A G 19: 11,896,929 R303G probably benign Het
Olfr352 T A 2: 36,870,268 I234N probably benign Het
Olfr463 T C 11: 87,893,223 R234G possibly damaging Het
Olfr52 T A 2: 86,182,102 Q3L probably benign Het
Olfr521 A T 7: 99,767,389 I76F probably damaging Het
Olfr672 C A 7: 104,996,178 C242F probably damaging Het
Olfr683 G A 7: 105,143,660 S211F probably benign Het
Olfr960 C T 9: 39,623,183 T20I probably damaging Het
Pard3 T G 8: 127,389,338 L636R probably damaging Het
Pigr A T 1: 130,844,527 S161C probably damaging Het
Polr1e T C 4: 45,029,369 S325P probably damaging Het
Prrc2a A T 17: 35,150,084 V1992E probably damaging Het
Ptpdc1 T C 13: 48,586,369 K468E probably benign Het
Rab22a A G 2: 173,661,504 T37A probably damaging Het
Rai14 T A 15: 10,575,159 K571I probably damaging Het
Reck G A 4: 43,930,979 G660D probably damaging Het
Rgs4 T C 1: 169,745,238 D43G possibly damaging Het
Ryr2 A T 13: 11,584,154 D4645E probably damaging Het
Sf3b3 A G 8: 110,823,470 S639P probably damaging Het
Slc27a4 G T 2: 29,811,660 R430L probably damaging Het
Slfn1 T A 11: 83,121,944 Y295* probably null Het
Slfn5 C T 11: 82,956,592 S101L probably damaging Het
Sult1d1 CCATG CCATGGCATG 5: 87,559,770 probably null Het
Tchh A T 3: 93,444,112 Q286H unknown Het
Tsc22d1 T G 14: 76,418,826 M833R possibly damaging Het
Ugt1a7c G T 1: 88,095,879 L253F probably damaging Het
Usp19 C T 9: 108,492,567 probably benign Het
Xirp2 T A 2: 67,524,804 I3303K possibly damaging Het
Zfp574 G A 7: 25,080,332 A260T probably benign Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Tmem184c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Tmem184c APN 8 77597146 nonsense probably null
IGL02024:Tmem184c APN 8 77604814 missense probably benign 0.10
IGL02231:Tmem184c APN 8 77604812 missense probably damaging 1.00
IGL02736:Tmem184c APN 8 77597846 missense probably damaging 1.00
IGL02934:Tmem184c APN 8 77597820 missense probably damaging 1.00
IGL03046:Tmem184c UTSW 8 77599657 nonsense probably null
R0107:Tmem184c UTSW 8 77597073 missense possibly damaging 0.78
R0107:Tmem184c UTSW 8 77597073 missense possibly damaging 0.78
R0189:Tmem184c UTSW 8 77597812 missense possibly damaging 0.92
R0564:Tmem184c UTSW 8 77606160 unclassified probably null
R0946:Tmem184c UTSW 8 77604757 missense probably damaging 1.00
R1629:Tmem184c UTSW 8 77602922 missense possibly damaging 0.87
R1629:Tmem184c UTSW 8 77606162 critical splice donor site probably null
R2261:Tmem184c UTSW 8 77597043 missense probably damaging 1.00
R2261:Tmem184c UTSW 8 77597175 missense probably damaging 0.99
R2919:Tmem184c UTSW 8 77604647 missense probably damaging 1.00
R3805:Tmem184c UTSW 8 77596875 missense unknown
R5418:Tmem184c UTSW 8 77597820 missense probably damaging 1.00
R5716:Tmem184c UTSW 8 77606407 missense possibly damaging 0.90
R5951:Tmem184c UTSW 8 77598662 splice site probably null
R6150:Tmem184c UTSW 8 77596440 missense probably benign 0.04
R7206:Tmem184c UTSW 8 77596577 missense possibly damaging 0.46
R7387:Tmem184c UTSW 8 77597930 nonsense probably null
R7899:Tmem184c UTSW 8 77597811 missense probably damaging 1.00
R7959:Tmem184c UTSW 8 77602903 missense possibly damaging 0.94
R8100:Tmem184c UTSW 8 77604782 missense possibly damaging 0.92
R8246:Tmem184c UTSW 8 77610185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCACAGCTCTGCCTAGC -3'
(R):5'- TGTAAGTATGCGACAAGATCCC -3'

Sequencing Primer
(F):5'- GCAGAGAGCGGACTTACG -3'
(R):5'- CGACAAGATCCCCAATTGTATGGTTG -3'
Posted On2017-02-28