Incidental Mutation 'R5934:Cdh5'
ID462107
Institutional Source Beutler Lab
Gene Symbol Cdh5
Ensembl Gene ENSMUSG00000031871
Gene Namecadherin 5
SynonymsVECD, VEcad, VE-cadherin, CD144, VE-Cad, 7B4/cadherin-5, VEC
MMRRC Submission 044128-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5934 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104101625-104144511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104138268 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 506 (V506E)
Ref Sequence ENSEMBL: ENSMUSP00000034339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034339]
PDB Structure
NMR structure of mouse Par3-PDZ3 in complex with VE-Cadherin C-terminus [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000034339
AA Change: V506E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034339
Gene: ENSMUSG00000031871
AA Change: V506E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 66 147 3.03e-10 SMART
CA 171 254 3.19e-18 SMART
CA 278 370 7.92e-14 SMART
CA 392 476 1.09e-16 SMART
CA 499 583 2.16e-6 SMART
transmembrane domain 598 620 N/A INTRINSIC
Pfam:Cadherin_C 625 776 1.1e-43 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein die in utero due to vascular insufficiency, caused by increased endothelial apoptosis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous inactivation or cytosolic truncation of this gene causes embryonic growth retardation, abnormal somite and heart development, impaired remodeling and maturation of endothelial cells, increased endothelial apoptosis and severe vascular defects leading to embryonic death at midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,930,806 V596A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg1l G A 10: 42,318,686 T370M probably damaging Het
Aldh2 T C 5: 121,579,615 T118A probably benign Het
Apcdd1 C T 18: 62,951,869 A379V possibly damaging Het
Atp1a3 T C 7: 24,978,874 probably benign Het
Cd96 G T 16: 46,117,903 D66E probably benign Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Ckb A T 12: 111,670,229 V237D probably damaging Het
Col6a6 C T 9: 105,767,075 D1306N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D1Ertd622e A T 1: 97,645,930 C137S possibly damaging Het
Ddhd2 A G 8: 25,753,113 S19P probably damaging Het
Dnah17 G T 11: 118,041,102 D3681E probably benign Het
Dopey1 T A 9: 86,542,442 Y2068* probably null Het
Fam26e A G 10: 34,092,202 V285A possibly damaging Het
Fryl T C 5: 73,090,717 Y1019C probably damaging Het
Fsip2 G A 2: 82,986,748 C4275Y possibly damaging Het
Gapdh A G 6: 125,162,701 V202A probably damaging Het
Gm8394 T C 10: 85,314,281 noncoding transcript Het
Gmeb2 T C 2: 181,255,574 I250M possibly damaging Het
Gpr88 C T 3: 116,252,309 G118R probably damaging Het
Hdhd3 C A 4: 62,499,370 V190L possibly damaging Het
Heg1 C T 16: 33,726,919 T461M probably damaging Het
Hspg2 A G 4: 137,518,772 Y989C probably damaging Het
Ift74 A T 4: 94,632,734 M175L probably benign Het
Kcnh3 G A 15: 99,226,533 R101Q possibly damaging Het
Kif20b G T 19: 34,941,321 V702F probably benign Het
Klhl1 A G 14: 96,123,215 probably null Het
Lrrk2 T C 15: 91,734,046 V916A probably benign Het
Mpp4 A T 1: 59,121,376 D589E probably damaging Het
Msl2 T C 9: 101,101,818 C464R probably damaging Het
Mucl2 A T 15: 103,897,566 S42T probably benign Het
Musk T A 4: 58,373,613 L838Q probably damaging Het
Nos1 A G 5: 117,936,445 H1052R probably damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr1420 A G 19: 11,896,929 R303G probably benign Het
Olfr352 T A 2: 36,870,268 I234N probably benign Het
Olfr463 T C 11: 87,893,223 R234G possibly damaging Het
Olfr52 T A 2: 86,182,102 Q3L probably benign Het
Olfr521 A T 7: 99,767,389 I76F probably damaging Het
Olfr672 C A 7: 104,996,178 C242F probably damaging Het
Olfr683 G A 7: 105,143,660 S211F probably benign Het
Olfr960 C T 9: 39,623,183 T20I probably damaging Het
Pard3 T G 8: 127,389,338 L636R probably damaging Het
Pigr A T 1: 130,844,527 S161C probably damaging Het
Polr1e T C 4: 45,029,369 S325P probably damaging Het
Prrc2a A T 17: 35,150,084 V1992E probably damaging Het
Ptpdc1 T C 13: 48,586,369 K468E probably benign Het
Rab22a A G 2: 173,661,504 T37A probably damaging Het
Rai14 T A 15: 10,575,159 K571I probably damaging Het
Reck G A 4: 43,930,979 G660D probably damaging Het
Rgs4 T C 1: 169,745,238 D43G possibly damaging Het
Ryr2 A T 13: 11,584,154 D4645E probably damaging Het
Sf3b3 A G 8: 110,823,470 S639P probably damaging Het
Slc27a4 G T 2: 29,811,660 R430L probably damaging Het
Slfn1 T A 11: 83,121,944 Y295* probably null Het
Slfn5 C T 11: 82,956,592 S101L probably damaging Het
Sult1d1 CCATG CCATGGCATG 5: 87,559,770 probably null Het
Tchh A T 3: 93,444,112 Q286H unknown Het
Tmem184c A T 8: 77,604,723 Y172* probably null Het
Tsc22d1 T G 14: 76,418,826 M833R possibly damaging Het
Ugt1a7c G T 1: 88,095,879 L253F probably damaging Het
Usp19 C T 9: 108,492,567 probably benign Het
Xirp2 T A 2: 67,524,804 I3303K possibly damaging Het
Zfp574 G A 7: 25,080,332 A260T probably benign Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Cdh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Cdh5 APN 8 104137817 missense probably damaging 1.00
IGL02506:Cdh5 APN 8 104137822 missense probably damaging 1.00
IGL02737:Cdh5 APN 8 104142928 missense probably damaging 1.00
IGL03287:Cdh5 APN 8 104128115 missense probably damaging 1.00
IGL03297:Cdh5 APN 8 104128199 missense probably damaging 1.00
R0015:Cdh5 UTSW 8 104140927 missense probably benign
R0015:Cdh5 UTSW 8 104140927 missense probably benign
R0126:Cdh5 UTSW 8 104140682 critical splice acceptor site probably null
R0167:Cdh5 UTSW 8 104136735 missense possibly damaging 0.51
R0592:Cdh5 UTSW 8 104130902 splice site probably null
R1760:Cdh5 UTSW 8 104128169 missense probably benign
R1826:Cdh5 UTSW 8 104131091 missense possibly damaging 0.93
R1827:Cdh5 UTSW 8 104112909 missense possibly damaging 0.96
R1840:Cdh5 UTSW 8 104126616 nonsense probably null
R1993:Cdh5 UTSW 8 104137815 missense probably damaging 0.97
R2219:Cdh5 UTSW 8 104142906 missense possibly damaging 0.94
R2239:Cdh5 UTSW 8 104125672 missense possibly damaging 0.54
R2281:Cdh5 UTSW 8 104125733 missense probably damaging 1.00
R2380:Cdh5 UTSW 8 104125672 missense possibly damaging 0.54
R3418:Cdh5 UTSW 8 104129370 missense probably damaging 0.98
R3419:Cdh5 UTSW 8 104129370 missense probably damaging 0.98
R3429:Cdh5 UTSW 8 104130968 missense possibly damaging 0.91
R4491:Cdh5 UTSW 8 104113040 missense probably damaging 1.00
R4823:Cdh5 UTSW 8 104142669 missense probably benign 0.00
R5071:Cdh5 UTSW 8 104140702 missense probably damaging 0.99
R5265:Cdh5 UTSW 8 104142739 missense probably benign 0.00
R5383:Cdh5 UTSW 8 104137847 missense probably benign 0.17
R5447:Cdh5 UTSW 8 104129362 missense probably damaging 0.99
R5580:Cdh5 UTSW 8 104125494 nonsense probably null
R5876:Cdh5 UTSW 8 104142577 missense probably damaging 1.00
R6378:Cdh5 UTSW 8 104126536 splice site probably null
R7110:Cdh5 UTSW 8 104140768 missense probably damaging 1.00
R7141:Cdh5 UTSW 8 104113001 missense probably benign 0.20
R7324:Cdh5 UTSW 8 104142793 missense probably damaging 1.00
R7658:Cdh5 UTSW 8 104129401 critical splice donor site probably null
R7806:Cdh5 UTSW 8 104140816 missense probably damaging 0.98
R7811:Cdh5 UTSW 8 104125603 missense possibly damaging 0.72
X0067:Cdh5 UTSW 8 104142537 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCATCCACCTAGAGTTTCCTAAG -3'
(R):5'- CACCCCATGTTGGATTAGTGC -3'

Sequencing Primer
(F):5'- GCTATTCCCATTTTACAGGAGGAG -3'
(R):5'- CCCCATGTTGGATTAGTGCTTGATC -3'
Posted On2017-02-28