Mutagenetix > Incidental Mutations

Incidental Mutation 'R5934:Dopey1'

462111

Institutional Source

Beutler Lab

Gene Symbol

Dopey1

Ensembl Gene

ENSMUSG00000034973

Gene Name

dopey family member 1

Synonyms

B130005I07Rik, D9Ertd809e

MMRRC Submission

044128-MU

Accession Numbers

Genbank: NM_177208; MGI: 1289294

Is this an essential gene?

Possibly non essential (E-score: 0.255) question?

Stock #

R5934 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86467154-86555923 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 86542442 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 2068 (Y2068*)

Ref Sequence

ENSEMBL: ENSMUSP00000140740 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185919] [ENSMUST00000189817] [ENSMUST00000190957]

Predicted Effect

probably null
Transcript: ENSMUST00000034987
AA Change: Y2068*

SMART Domains

Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973
AA Change: Y2068*

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	11	300	1e-117	PFAM
low complexity region	631	649	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	1073	1084	N/A	INTRINSIC
low complexity region	1105	1118	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1296	1318	N/A	INTRINSIC
low complexity region	1335	1344	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
low complexity region	1575	1589	N/A	INTRINSIC
low complexity region	2217	2227	N/A	INTRINSIC
low complexity region	2351	2362	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185919

SMART Domains

Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	10	306	1.9e-106	PFAM
low complexity region	629	647	N/A	INTRINSIC
low complexity region	959	971	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1103	1116	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
low complexity region	1294	1316	N/A	INTRINSIC
low complexity region	1333	1342	N/A	INTRINSIC
low complexity region	1360	1371	N/A	INTRINSIC
low complexity region	1573	1587	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186715

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187348

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189564

Predicted Effect

probably null
Transcript: ENSMUST00000189817
AA Change: Y136*

Predicted Effect

probably null
Transcript: ENSMUST00000190957
AA Change: Y2068*

SMART Domains

Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973
AA Change: Y2068*

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	10	305	1.3e-108	PFAM
low complexity region	631	649	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	1073	1084	N/A	INTRINSIC
low complexity region	1105	1118	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1296	1318	N/A	INTRINSIC
low complexity region	1335	1344	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
low complexity region	1575	1589	N/A	INTRINSIC
low complexity region	2217	2227	N/A	INTRINSIC
low complexity region	2351	2362	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194336

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194439

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	T	C	5: 8,930,806	V596A	probably benign	Het
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Afg1l	G	A	10: 42,318,686	T370M	probably damaging	Het
Aldh2	T	C	5: 121,579,615	T118A	probably benign	Het
Apcdd1	C	T	18: 62,951,869	A379V	possibly damaging	Het
Atp1a3	T	C	7: 24,978,874		probably benign	Het
Cd96	G	T	16: 46,117,903	D66E	probably benign	Het
Cdh5	T	A	8: 104,138,268	V506E	probably benign	Het
Cep70	T	C	9: 99,254,265	I7T	probably benign	Het
Ckb	A	T	12: 111,670,229	V237D	probably damaging	Het
Col6a6	C	T	9: 105,767,075	D1306N	probably damaging	Het
Cysltr2	T	C	14: 73,029,491	K260E	probably benign	Het
D1Ertd622e	A	T	1: 97,645,930	C137S	possibly damaging	Het
Ddhd2	A	G	8: 25,753,113	S19P	probably damaging	Het
Dnah17	G	T	11: 118,041,102	D3681E	probably benign	Het
Fam26e	A	G	10: 34,092,202	V285A	possibly damaging	Het
Fryl	T	C	5: 73,090,717	Y1019C	probably damaging	Het
Fsip2	G	A	2: 82,986,748	C4275Y	possibly damaging	Het
Gapdh	A	G	6: 125,162,701	V202A	probably damaging	Het
Gm8394	T	C	10: 85,314,281		noncoding transcript	Het
Gmeb2	T	C	2: 181,255,574	I250M	possibly damaging	Het
Gpr88	C	T	3: 116,252,309	G118R	probably damaging	Het
Hdhd3	C	A	4: 62,499,370	V190L	possibly damaging	Het
Heg1	C	T	16: 33,726,919	T461M	probably damaging	Het
Hspg2	A	G	4: 137,518,772	Y989C	probably damaging	Het
Ift74	A	T	4: 94,632,734	M175L	probably benign	Het
Kcnh3	G	A	15: 99,226,533	R101Q	possibly damaging	Het
Kif20b	G	T	19: 34,941,321	V702F	probably benign	Het
Klhl1	A	G	14: 96,123,215		probably null	Het
Lrrk2	T	C	15: 91,734,046	V916A	probably benign	Het
Mpp4	A	T	1: 59,121,376	D589E	probably damaging	Het
Msl2	T	C	9: 101,101,818	C464R	probably damaging	Het
Mucl2	A	T	15: 103,897,566	S42T	probably benign	Het
Musk	T	A	4: 58,373,613	L838Q	probably damaging	Het
Nos1	A	G	5: 117,936,445	H1052R	probably damaging	Het
Olfr1151	T	C	2: 87,857,241	V22A	probably benign	Het
Olfr1420	A	G	19: 11,896,929	R303G	probably benign	Het
Olfr352	T	A	2: 36,870,268	I234N	probably benign	Het
Olfr463	T	C	11: 87,893,223	R234G	possibly damaging	Het
Olfr52	T	A	2: 86,182,102	Q3L	probably benign	Het
Olfr521	A	T	7: 99,767,389	I76F	probably damaging	Het
Olfr672	C	A	7: 104,996,178	C242F	probably damaging	Het
Olfr683	G	A	7: 105,143,660	S211F	probably benign	Het
Olfr960	C	T	9: 39,623,183	T20I	probably damaging	Het
Pard3	T	G	8: 127,389,338	L636R	probably damaging	Het
Pigr	A	T	1: 130,844,527	S161C	probably damaging	Het
Polr1e	T	C	4: 45,029,369	S325P	probably damaging	Het
Prrc2a	A	T	17: 35,150,084	V1992E	probably damaging	Het
Ptpdc1	T	C	13: 48,586,369	K468E	probably benign	Het
Rab22a	A	G	2: 173,661,504	T37A	probably damaging	Het
Rai14	T	A	15: 10,575,159	K571I	probably damaging	Het
Reck	G	A	4: 43,930,979	G660D	probably damaging	Het
Rgs4	T	C	1: 169,745,238	D43G	possibly damaging	Het
Ryr2	A	T	13: 11,584,154	D4645E	probably damaging	Het
Sf3b3	A	G	8: 110,823,470	S639P	probably damaging	Het
Slc27a4	G	T	2: 29,811,660	R430L	probably damaging	Het
Slfn1	T	A	11: 83,121,944	Y295*	probably null	Het
Slfn5	C	T	11: 82,956,592	S101L	probably damaging	Het
Sult1d1	CCATG	CCATGGCATG	5: 87,559,770		probably null	Het
Tchh	A	T	3: 93,444,112	Q286H	unknown	Het
Tmem184c	A	T	8: 77,604,723	Y172*	probably null	Het
Tsc22d1	T	G	14: 76,418,826	M833R	possibly damaging	Het
Ugt1a7c	G	T	1: 88,095,879	L253F	probably damaging	Het
Usp19	C	T	9: 108,492,567		probably benign	Het
Xirp2	T	A	2: 67,524,804	I3303K	possibly damaging	Het
Zfp574	G	A	7: 25,080,332	A260T	probably benign	Het
Zswim6	A	G	13: 107,744,107		noncoding transcript	Het

Other mutations in Dopey1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Dopey1	APN	9	86551679	missense	possibly damaging	0.57
IGL00427:Dopey1	APN	9	86521500	missense	probably benign	0.09
IGL00427:Dopey1	APN	9	86521498	missense	possibly damaging	0.93
IGL00427:Dopey1	APN	9	86521499	missense	probably damaging	0.96
IGL00577:Dopey1	APN	9	86520946	missense	probably damaging	1.00
IGL00741:Dopey1	APN	9	86522806	missense	possibly damaging	0.50
IGL00959:Dopey1	APN	9	86487431	missense	probably damaging	1.00
IGL01339:Dopey1	APN	9	86551677	missense	possibly damaging	0.90
IGL01608:Dopey1	APN	9	86507561	missense	probably benign	0.23
IGL01760:Dopey1	APN	9	86519923	missense	probably benign
IGL01788:Dopey1	APN	9	86531719	missense	probably benign	0.03
IGL01844:Dopey1	APN	9	86514085	missense	probably damaging	1.00
IGL01923:Dopey1	APN	9	86522867	missense	probably damaging	1.00
IGL02036:Dopey1	APN	9	86531765	missense	probably benign	0.18
IGL02308:Dopey1	APN	9	86520088	missense	probably damaging	0.98
IGL02494:Dopey1	APN	9	86526818	missense	probably damaging	1.00
IGL02698:Dopey1	APN	9	86524359	splice site	probably benign
IGL02731:Dopey1	APN	9	86487381	missense	probably damaging	1.00
IGL02821:Dopey1	APN	9	86520156	missense	probably benign
IGL02952:Dopey1	APN	9	86532922	splice site	probably benign
IGL03071:Dopey1	APN	9	86489615	missense	possibly damaging	0.91
IGL03271:Dopey1	APN	9	86504222	nonsense	probably null
IGL03344:Dopey1	APN	9	86536144	missense	probably damaging	1.00
Beg	UTSW	9	86548172	nonsense	probably null
groak	UTSW	9	86521657	missense	probably damaging	1.00
R0055:Dopey1	UTSW	9	86512652	missense	probably benign	0.08
R0285:Dopey1	UTSW	9	86512639	missense	probably damaging	1.00
R0415:Dopey1	UTSW	9	86506502	missense	probably damaging	1.00
R0427:Dopey1	UTSW	9	86507532	missense	probably damaging	1.00
R0514:Dopey1	UTSW	9	86520734	missense	probably damaging	1.00
R0538:Dopey1	UTSW	9	86485497	missense	probably damaging	1.00
R1118:Dopey1	UTSW	9	86515406	missense	probably damaging	1.00
R1158:Dopey1	UTSW	9	86485556	missense	probably damaging	1.00
R1272:Dopey1	UTSW	9	86521424	missense	probably damaging	1.00
R1448:Dopey1	UTSW	9	86542732	splice site	probably null
R1584:Dopey1	UTSW	9	86548172	nonsense	probably null
R1601:Dopey1	UTSW	9	86536250	missense	probably damaging	0.99
R1674:Dopey1	UTSW	9	86536160	missense	probably damaging	0.98
R1706:Dopey1	UTSW	9	86554080	missense	possibly damaging	0.92
R1856:Dopey1	UTSW	9	86492004	missense	probably damaging	0.99
R1926:Dopey1	UTSW	9	86523019	missense	probably damaging	1.00
R1929:Dopey1	UTSW	9	86494418	missense	probably damaging	1.00
R2029:Dopey1	UTSW	9	86521365	missense	probably damaging	1.00
R2125:Dopey1	UTSW	9	86521046	missense	probably damaging	1.00
R2206:Dopey1	UTSW	9	86521599	missense	probably benign	0.00
R2271:Dopey1	UTSW	9	86494418	missense	probably damaging	1.00
R2312:Dopey1	UTSW	9	86521442	nonsense	probably null
R2379:Dopey1	UTSW	9	86521085	missense	probably damaging	1.00
R2507:Dopey1	UTSW	9	86513117	missense	probably damaging	1.00
R3737:Dopey1	UTSW	9	86494433	missense	probably damaging	1.00
R3804:Dopey1	UTSW	9	86520995	missense	probably damaging	1.00
R3916:Dopey1	UTSW	9	86521133	missense	probably damaging	1.00
R3921:Dopey1	UTSW	9	86520271	missense	probably benign	0.06
R4035:Dopey1	UTSW	9	86494433	missense	probably damaging	1.00
R4392:Dopey1	UTSW	9	86503143	intron	probably benign
R4404:Dopey1	UTSW	9	86522813	nonsense	probably null
R4513:Dopey1	UTSW	9	86520559	missense	probably benign	0.39
R4624:Dopey1	UTSW	9	86521525	missense	probably damaging	1.00
R4659:Dopey1	UTSW	9	86502032	intron	probably benign
R4910:Dopey1	UTSW	9	86492061	missense	probably damaging	1.00
R4919:Dopey1	UTSW	9	86520056	missense	possibly damaging	0.47
R5061:Dopey1	UTSW	9	86503108	splice site	probably benign
R5079:Dopey1	UTSW	9	86487421	missense	probably damaging	1.00
R5118:Dopey1	UTSW	9	86506259	missense	probably damaging	1.00
R5169:Dopey1	UTSW	9	86533021	missense	probably damaging	1.00
R5176:Dopey1	UTSW	9	86521815	missense	probably damaging	1.00
R5190:Dopey1	UTSW	9	86487304	missense	probably damaging	1.00
R5256:Dopey1	UTSW	9	86515328	missense	probably damaging	1.00
R5346:Dopey1	UTSW	9	86520782	missense	probably damaging	1.00
R5484:Dopey1	UTSW	9	86545288	missense	probably damaging	1.00
R5501:Dopey1	UTSW	9	86507730	missense	probably benign	0.04
R5554:Dopey1	UTSW	9	86521657	missense	probably damaging	1.00
R5707:Dopey1	UTSW	9	86502997	missense	possibly damaging	0.95
R5826:Dopey1	UTSW	9	86507570	missense	possibly damaging	0.94
R5921:Dopey1	UTSW	9	86501922	missense	probably damaging	1.00
R5936:Dopey1	UTSW	9	86536512	nonsense	probably null
R6046:Dopey1	UTSW	9	86515343	missense	probably damaging	1.00
R6053:Dopey1	UTSW	9	86515294	missense	possibly damaging	0.95
R6072:Dopey1	UTSW	9	86507697	missense	probably benign	0.00
R6104:Dopey1	UTSW	9	86520807	missense	possibly damaging	0.86
R6125:Dopey1	UTSW	9	86521133	missense	probably damaging	1.00
R6299:Dopey1	UTSW	9	86504212	missense	probably damaging	1.00
R6930:Dopey1	UTSW	9	86531772	critical splice donor site	probably null
R6949:Dopey1	UTSW	9	86500860	missense	probably damaging	1.00
R6979:Dopey1	UTSW	9	86521642	missense	possibly damaging	0.77
R7035:Dopey1	UTSW	9	86524302	missense	possibly damaging	0.85
R7069:Dopey1	UTSW	9	86550169	critical splice donor site	probably null
R7101:Dopey1	UTSW	9	86507669	missense	probably benign
R7202:Dopey1	UTSW	9	86504167	splice site	probably null
R7222:Dopey1	UTSW	9	86522876	critical splice donor site	probably null
R7233:Dopey1	UTSW	9	86521696	missense	probably benign	0.00
R7236:Dopey1	UTSW	9	86515378	missense	probably damaging	1.00
R7252:Dopey1	UTSW	9	86500821	missense	probably damaging	1.00
R7268:Dopey1	UTSW	9	86512777	nonsense	probably null
R7353:Dopey1	UTSW	9	86512859	missense	probably damaging	0.99
R7481:Dopey1	UTSW	9	86535932	missense	probably damaging	1.00
R7498:Dopey1	UTSW	9	86494411	missense	possibly damaging	0.95
R7507:Dopey1	UTSW	9	86535949	missense	probably benign	0.01
R7525:Dopey1	UTSW	9	86506290	missense	probably damaging	1.00
R7539:Dopey1	UTSW	9	86521573	missense	probably benign	0.03
R7751:Dopey1	UTSW	9	86507730	missense	probably benign	0.00
R7753:Dopey1	UTSW	9	86489702	missense	possibly damaging	0.52
R7839:Dopey1	UTSW	9	86542765	nonsense	probably null
R7868:Dopey1	UTSW	9	86501984	critical splice donor site	probably null
R7922:Dopey1	UTSW	9	86542765	nonsense	probably null
R7951:Dopey1	UTSW	9	86501984	critical splice donor site	probably null
R8061:Dopey1	UTSW	9	86521193	missense	possibly damaging	0.95
R8067:Dopey1	UTSW	9	86518339	missense	probably benign	0.00
RF004:Dopey1	UTSW	9	86554191	missense	probably benign
X0019:Dopey1	UTSW	9	86506227	missense	probably damaging	1.00
X0019:Dopey1	UTSW	9	86531750	missense	probably damaging	0.98
ZE80:Dopey1	UTSW	9	86500842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATCTGGGAAAGAGTTTGACTTG -3'
(R):5'- CCTCAGATACTAACATGGAAGCAAG -3'

Sequencing Primer
(F):5'- GGAAAGAGTTTGACTTGTAAGGTC -3'
(R):5'- GTCACCATAAGAAAAGTGAGACAC -3'

Posted On

2017-02-28