Incidental Mutation 'R5934:Afg1l'
ID462117
Institutional Source Beutler Lab
Gene Symbol Afg1l
Ensembl Gene ENSMUSG00000038302
Gene NameAFG1 like ATPase
SynonymsLace1
MMRRC Submission 044128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5934 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location42312585-42478565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42318686 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 370 (T370M)
Ref Sequence ENSEMBL: ENSMUSP00000036149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041024] [ENSMUST00000133326]
Predicted Effect probably damaging
Transcript: ENSMUST00000041024
AA Change: T370M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036149
Gene: ENSMUSG00000038302
AA Change: T370M

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 74 432 4.4e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133326
SMART Domains Protein: ENSMUSP00000123510
Gene: ENSMUSG00000038302

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 73 272 2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149832
SMART Domains Protein: ENSMUSP00000119620
Gene: ENSMUSG00000038302

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 2 80 5.3e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000151747
AA Change: T237M
SMART Domains Protein: ENSMUSP00000120389
Gene: ENSMUSG00000038302
AA Change: T237M

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 5 300 2e-97 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial integral membrane protein that plays a role in mitochondrial protein homeostasis. The protein contains a P-loop motif and a five-domain structure that is conserved in fly, yeast, and bacteria. It functions to mediate the degradation of nuclear-encoded complex IV subunits. Two conserved estrogen receptor binding sites are located within 2.5 kb of this gene. Polymorphisms in this gene have been associated with bipolar disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,930,806 V596A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aldh2 T C 5: 121,579,615 T118A probably benign Het
Apcdd1 C T 18: 62,951,869 A379V possibly damaging Het
Atp1a3 T C 7: 24,978,874 probably benign Het
Cd96 G T 16: 46,117,903 D66E probably benign Het
Cdh5 T A 8: 104,138,268 V506E probably benign Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Ckb A T 12: 111,670,229 V237D probably damaging Het
Col6a6 C T 9: 105,767,075 D1306N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D1Ertd622e A T 1: 97,645,930 C137S possibly damaging Het
Ddhd2 A G 8: 25,753,113 S19P probably damaging Het
Dnah17 G T 11: 118,041,102 D3681E probably benign Het
Dopey1 T A 9: 86,542,442 Y2068* probably null Het
Fam26e A G 10: 34,092,202 V285A possibly damaging Het
Fryl T C 5: 73,090,717 Y1019C probably damaging Het
Fsip2 G A 2: 82,986,748 C4275Y possibly damaging Het
Gapdh A G 6: 125,162,701 V202A probably damaging Het
Gm8394 T C 10: 85,314,281 noncoding transcript Het
Gmeb2 T C 2: 181,255,574 I250M possibly damaging Het
Gpr88 C T 3: 116,252,309 G118R probably damaging Het
Hdhd3 C A 4: 62,499,370 V190L possibly damaging Het
Heg1 C T 16: 33,726,919 T461M probably damaging Het
Hspg2 A G 4: 137,518,772 Y989C probably damaging Het
Ift74 A T 4: 94,632,734 M175L probably benign Het
Kcnh3 G A 15: 99,226,533 R101Q possibly damaging Het
Kif20b G T 19: 34,941,321 V702F probably benign Het
Klhl1 A G 14: 96,123,215 probably null Het
Lrrk2 T C 15: 91,734,046 V916A probably benign Het
Mpp4 A T 1: 59,121,376 D589E probably damaging Het
Msl2 T C 9: 101,101,818 C464R probably damaging Het
Mucl2 A T 15: 103,897,566 S42T probably benign Het
Musk T A 4: 58,373,613 L838Q probably damaging Het
Nos1 A G 5: 117,936,445 H1052R probably damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr1420 A G 19: 11,896,929 R303G probably benign Het
Olfr352 T A 2: 36,870,268 I234N probably benign Het
Olfr463 T C 11: 87,893,223 R234G possibly damaging Het
Olfr52 T A 2: 86,182,102 Q3L probably benign Het
Olfr521 A T 7: 99,767,389 I76F probably damaging Het
Olfr672 C A 7: 104,996,178 C242F probably damaging Het
Olfr683 G A 7: 105,143,660 S211F probably benign Het
Olfr960 C T 9: 39,623,183 T20I probably damaging Het
Pard3 T G 8: 127,389,338 L636R probably damaging Het
Pigr A T 1: 130,844,527 S161C probably damaging Het
Polr1e T C 4: 45,029,369 S325P probably damaging Het
Prrc2a A T 17: 35,150,084 V1992E probably damaging Het
Ptpdc1 T C 13: 48,586,369 K468E probably benign Het
Rab22a A G 2: 173,661,504 T37A probably damaging Het
Rai14 T A 15: 10,575,159 K571I probably damaging Het
Reck G A 4: 43,930,979 G660D probably damaging Het
Rgs4 T C 1: 169,745,238 D43G possibly damaging Het
Ryr2 A T 13: 11,584,154 D4645E probably damaging Het
Sf3b3 A G 8: 110,823,470 S639P probably damaging Het
Slc27a4 G T 2: 29,811,660 R430L probably damaging Het
Slfn1 T A 11: 83,121,944 Y295* probably null Het
Slfn5 C T 11: 82,956,592 S101L probably damaging Het
Sult1d1 CCATG CCATGGCATG 5: 87,559,770 probably null Het
Tchh A T 3: 93,444,112 Q286H unknown Het
Tmem184c A T 8: 77,604,723 Y172* probably null Het
Tsc22d1 T G 14: 76,418,826 M833R possibly damaging Het
Ugt1a7c G T 1: 88,095,879 L253F probably damaging Het
Usp19 C T 9: 108,492,567 probably benign Het
Xirp2 T A 2: 67,524,804 I3303K possibly damaging Het
Zfp574 G A 7: 25,080,332 A260T probably benign Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Afg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Afg1l APN 10 42339911 missense possibly damaging 0.86
IGL02041:Afg1l APN 10 42454380 missense probably damaging 0.98
IGL02309:Afg1l APN 10 42454378 missense possibly damaging 0.90
IGL02323:Afg1l APN 10 42454510 nonsense probably null
IGL03088:Afg1l APN 10 42426497 missense probably damaging 1.00
PIT4458001:Afg1l UTSW 10 42454370 nonsense probably null
R0969:Afg1l UTSW 10 42318621 missense probably damaging 1.00
R1665:Afg1l UTSW 10 42426577 missense probably damaging 1.00
R1703:Afg1l UTSW 10 42400399 missense probably damaging 1.00
R1766:Afg1l UTSW 10 42454495 missense probably benign 0.00
R2941:Afg1l UTSW 10 42478295 splice site probably null
R4846:Afg1l UTSW 10 42454494 missense probably benign 0.02
R4887:Afg1l UTSW 10 42454378 missense probably benign 0.00
R5668:Afg1l UTSW 10 42360240 missense probably damaging 1.00
R6575:Afg1l UTSW 10 42318716 missense probably damaging 1.00
R6972:Afg1l UTSW 10 42478374 missense probably benign 0.00
R7270:Afg1l UTSW 10 42425249 missense probably damaging 1.00
R7271:Afg1l UTSW 10 42415548 critical splice donor site probably null
R7577:Afg1l UTSW 10 42318611 missense probably damaging 1.00
R8458:Afg1l UTSW 10 42426521 missense probably damaging 0.98
Z1176:Afg1l UTSW 10 42478353 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCAGCTTGTAACGGAGCTTG -3'
(R):5'- AAAACTGCCTCATCGGGTC -3'

Sequencing Primer
(F):5'- GCTTGTAACGGAGCTTGACACTAC -3'
(R):5'- AAAACTGCCTCATCGGGTCTAGTC -3'
Posted On2017-02-28