Incidental Mutation 'R5934:Olfr463'
ID462122
Institutional Source Beutler Lab
Gene Symbol Olfr463
Ensembl Gene ENSMUSG00000093920
Gene Nameolfactory receptor 463
SynonymsGA_x6K02T2PAEV-9540823-9539888, MOR240-1
MMRRC Submission 044128-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R5934 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87892618-87897387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87893223 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 234 (R234G)
Ref Sequence ENSEMBL: ENSMUSP00000149255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049743] [ENSMUST00000081417] [ENSMUST00000213672] [ENSMUST00000213928] [ENSMUST00000215150] [ENSMUST00000217095]
Predicted Effect probably benign
Transcript: ENSMUST00000049743
SMART Domains Protein: ENSMUSP00000055334
Gene: ENSMUSG00000093839

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.2e-40 PFAM
Pfam:7tm_1 41 287 1.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081417
AA Change: R234G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080146
Gene: ENSMUSG00000093920
AA Change: R234G

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 6.3e-41 PFAM
Pfam:7tm_1 41 287 8.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213672
Predicted Effect probably benign
Transcript: ENSMUST00000213928
Predicted Effect possibly damaging
Transcript: ENSMUST00000215150
AA Change: R234G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217095
AA Change: R234G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,930,806 V596A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg1l G A 10: 42,318,686 T370M probably damaging Het
Aldh2 T C 5: 121,579,615 T118A probably benign Het
Apcdd1 C T 18: 62,951,869 A379V possibly damaging Het
Atp1a3 T C 7: 24,978,874 probably benign Het
Cd96 G T 16: 46,117,903 D66E probably benign Het
Cdh5 T A 8: 104,138,268 V506E probably benign Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Ckb A T 12: 111,670,229 V237D probably damaging Het
Col6a6 C T 9: 105,767,075 D1306N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D1Ertd622e A T 1: 97,645,930 C137S possibly damaging Het
Ddhd2 A G 8: 25,753,113 S19P probably damaging Het
Dnah17 G T 11: 118,041,102 D3681E probably benign Het
Dopey1 T A 9: 86,542,442 Y2068* probably null Het
Fam26e A G 10: 34,092,202 V285A possibly damaging Het
Fryl T C 5: 73,090,717 Y1019C probably damaging Het
Fsip2 G A 2: 82,986,748 C4275Y possibly damaging Het
Gapdh A G 6: 125,162,701 V202A probably damaging Het
Gm8394 T C 10: 85,314,281 noncoding transcript Het
Gmeb2 T C 2: 181,255,574 I250M possibly damaging Het
Gpr88 C T 3: 116,252,309 G118R probably damaging Het
Hdhd3 C A 4: 62,499,370 V190L possibly damaging Het
Heg1 C T 16: 33,726,919 T461M probably damaging Het
Hspg2 A G 4: 137,518,772 Y989C probably damaging Het
Ift74 A T 4: 94,632,734 M175L probably benign Het
Kcnh3 G A 15: 99,226,533 R101Q possibly damaging Het
Kif20b G T 19: 34,941,321 V702F probably benign Het
Klhl1 A G 14: 96,123,215 probably null Het
Lrrk2 T C 15: 91,734,046 V916A probably benign Het
Mpp4 A T 1: 59,121,376 D589E probably damaging Het
Msl2 T C 9: 101,101,818 C464R probably damaging Het
Mucl2 A T 15: 103,897,566 S42T probably benign Het
Musk T A 4: 58,373,613 L838Q probably damaging Het
Nos1 A G 5: 117,936,445 H1052R probably damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr1420 A G 19: 11,896,929 R303G probably benign Het
Olfr352 T A 2: 36,870,268 I234N probably benign Het
Olfr52 T A 2: 86,182,102 Q3L probably benign Het
Olfr521 A T 7: 99,767,389 I76F probably damaging Het
Olfr672 C A 7: 104,996,178 C242F probably damaging Het
Olfr683 G A 7: 105,143,660 S211F probably benign Het
Olfr960 C T 9: 39,623,183 T20I probably damaging Het
Pard3 T G 8: 127,389,338 L636R probably damaging Het
Pigr A T 1: 130,844,527 S161C probably damaging Het
Polr1e T C 4: 45,029,369 S325P probably damaging Het
Prrc2a A T 17: 35,150,084 V1992E probably damaging Het
Ptpdc1 T C 13: 48,586,369 K468E probably benign Het
Rab22a A G 2: 173,661,504 T37A probably damaging Het
Rai14 T A 15: 10,575,159 K571I probably damaging Het
Reck G A 4: 43,930,979 G660D probably damaging Het
Rgs4 T C 1: 169,745,238 D43G possibly damaging Het
Ryr2 A T 13: 11,584,154 D4645E probably damaging Het
Sf3b3 A G 8: 110,823,470 S639P probably damaging Het
Slc27a4 G T 2: 29,811,660 R430L probably damaging Het
Slfn1 T A 11: 83,121,944 Y295* probably null Het
Slfn5 C T 11: 82,956,592 S101L probably damaging Het
Sult1d1 CCATG CCATGGCATG 5: 87,559,770 probably null Het
Tchh A T 3: 93,444,112 Q286H unknown Het
Tmem184c A T 8: 77,604,723 Y172* probably null Het
Tsc22d1 T G 14: 76,418,826 M833R possibly damaging Het
Ugt1a7c G T 1: 88,095,879 L253F probably damaging Het
Usp19 C T 9: 108,492,567 probably benign Het
Xirp2 T A 2: 67,524,804 I3303K possibly damaging Het
Zfp574 G A 7: 25,080,332 A260T probably benign Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Olfr463
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Olfr463 APN 11 87893365 missense possibly damaging 0.46
IGL00481:Olfr463 APN 11 87893621 missense possibly damaging 0.52
R0463:Olfr463 UTSW 11 87893196 missense probably damaging 1.00
R0608:Olfr463 UTSW 11 87893196 missense probably damaging 1.00
R2984:Olfr463 UTSW 11 87893746 missense possibly damaging 0.90
R3055:Olfr463 UTSW 11 87893372 missense possibly damaging 0.95
R5276:Olfr463 UTSW 11 87893192 missense probably damaging 1.00
R5517:Olfr463 UTSW 11 87893066 missense probably damaging 1.00
R5540:Olfr463 UTSW 11 87893685 nonsense probably null
R6002:Olfr463 UTSW 11 87893807 missense probably damaging 0.99
R6602:Olfr463 UTSW 11 87893652 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCTGAGCGTGTAGATCATGG -3'
(R):5'- TGTCCAGCTGTCTCTGATGC -3'

Sequencing Primer
(F):5'- AGATCATGGGGTTGAGCATG -3'
(R):5'- GACCCAATGTCCTGGATAACTTC -3'
Posted On2017-02-28