Mutagenetix > Incidental Mutations

Incidental Mutation 'R5934:Kcnh3'

462133

Institutional Source

Beutler Lab

Gene Symbol

Kcnh3

Ensembl Gene

ENSMUSG00000037579

Gene Name

potassium voltage-gated channel, subfamily H (eag-related), member 3

Synonyms

Elk2, Melk2, C030044P22Rik, ether a go-go like

MMRRC Submission

044128-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5934 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99224861-99242817 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 99226533 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 101 (R101Q)

Ref Sequence

ENSEMBL: ENSMUSP00000040548 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041415]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041415
AA Change: R101Q

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000040548
Gene: ENSMUSG00000037579
AA Change: R101Q

Domain	Start	End	E-Value	Type
PAS	20	88	3.94e0	SMART
PAC	94	136	9.92e-6	SMART
low complexity region	148	159	N/A	INTRINSIC
Pfam:Ion_trans	224	523	3.8e-34	PFAM
Pfam:Ion_trans_2	453	517	1e-12	PFAM
cNMP	593	708	2.04e-16	SMART
low complexity region	781	800	N/A	INTRINSIC
low complexity region	857	872	N/A	INTRINSIC
coiled coil region	886	918	N/A	INTRINSIC
low complexity region	977	993	N/A	INTRINSIC
low complexity region	1022	1035	N/A	INTRINSIC
low complexity region	1054	1062	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228983

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a voltage-gated potassium channel alpha subunit predominantly expressed in the forebrain. An increase in cognitive function was observed when this gene was knocked out, while deletion of the gene resulted in hippocampal hyperexcitability and epilepsy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal long term object recognition memory, spatial reference memory, spatial working memory, and long term potentiation. Mice homozygous for a different knock-out allele exhibit neuron hyperexcitability and seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	T	C	5: 8,930,806	V596A	probably benign	Het
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Afg1l	G	A	10: 42,318,686	T370M	probably damaging	Het
Aldh2	T	C	5: 121,579,615	T118A	probably benign	Het
Apcdd1	C	T	18: 62,951,869	A379V	possibly damaging	Het
Atp1a3	T	C	7: 24,978,874		probably benign	Het
Cd96	G	T	16: 46,117,903	D66E	probably benign	Het
Cdh5	T	A	8: 104,138,268	V506E	probably benign	Het
Cep70	T	C	9: 99,254,265	I7T	probably benign	Het
Ckb	A	T	12: 111,670,229	V237D	probably damaging	Het
Col6a6	C	T	9: 105,767,075	D1306N	probably damaging	Het
Cysltr2	T	C	14: 73,029,491	K260E	probably benign	Het
D1Ertd622e	A	T	1: 97,645,930	C137S	possibly damaging	Het
Ddhd2	A	G	8: 25,753,113	S19P	probably damaging	Het
Dnah17	G	T	11: 118,041,102	D3681E	probably benign	Het
Dopey1	T	A	9: 86,542,442	Y2068*	probably null	Het
Fam26e	A	G	10: 34,092,202	V285A	possibly damaging	Het
Fryl	T	C	5: 73,090,717	Y1019C	probably damaging	Het
Fsip2	G	A	2: 82,986,748	C4275Y	possibly damaging	Het
Gapdh	A	G	6: 125,162,701	V202A	probably damaging	Het
Gm8394	T	C	10: 85,314,281		noncoding transcript	Het
Gmeb2	T	C	2: 181,255,574	I250M	possibly damaging	Het
Gpr88	C	T	3: 116,252,309	G118R	probably damaging	Het
Hdhd3	C	A	4: 62,499,370	V190L	possibly damaging	Het
Heg1	C	T	16: 33,726,919	T461M	probably damaging	Het
Hspg2	A	G	4: 137,518,772	Y989C	probably damaging	Het
Ift74	A	T	4: 94,632,734	M175L	probably benign	Het
Kif20b	G	T	19: 34,941,321	V702F	probably benign	Het
Klhl1	A	G	14: 96,123,215		probably null	Het
Lrrk2	T	C	15: 91,734,046	V916A	probably benign	Het
Mpp4	A	T	1: 59,121,376	D589E	probably damaging	Het
Msl2	T	C	9: 101,101,818	C464R	probably damaging	Het
Mucl2	A	T	15: 103,897,566	S42T	probably benign	Het
Musk	T	A	4: 58,373,613	L838Q	probably damaging	Het
Nos1	A	G	5: 117,936,445	H1052R	probably damaging	Het
Olfr1151	T	C	2: 87,857,241	V22A	probably benign	Het
Olfr1420	A	G	19: 11,896,929	R303G	probably benign	Het
Olfr352	T	A	2: 36,870,268	I234N	probably benign	Het
Olfr463	T	C	11: 87,893,223	R234G	possibly damaging	Het
Olfr52	T	A	2: 86,182,102	Q3L	probably benign	Het
Olfr521	A	T	7: 99,767,389	I76F	probably damaging	Het
Olfr672	C	A	7: 104,996,178	C242F	probably damaging	Het
Olfr683	G	A	7: 105,143,660	S211F	probably benign	Het
Olfr960	C	T	9: 39,623,183	T20I	probably damaging	Het
Pard3	T	G	8: 127,389,338	L636R	probably damaging	Het
Pigr	A	T	1: 130,844,527	S161C	probably damaging	Het
Polr1e	T	C	4: 45,029,369	S325P	probably damaging	Het
Prrc2a	A	T	17: 35,150,084	V1992E	probably damaging	Het
Ptpdc1	T	C	13: 48,586,369	K468E	probably benign	Het
Rab22a	A	G	2: 173,661,504	T37A	probably damaging	Het
Rai14	T	A	15: 10,575,159	K571I	probably damaging	Het
Reck	G	A	4: 43,930,979	G660D	probably damaging	Het
Rgs4	T	C	1: 169,745,238	D43G	possibly damaging	Het
Ryr2	A	T	13: 11,584,154	D4645E	probably damaging	Het
Sf3b3	A	G	8: 110,823,470	S639P	probably damaging	Het
Slc27a4	G	T	2: 29,811,660	R430L	probably damaging	Het
Slfn1	T	A	11: 83,121,944	Y295*	probably null	Het
Slfn5	C	T	11: 82,956,592	S101L	probably damaging	Het
Sult1d1	CCATG	CCATGGCATG	5: 87,559,770		probably null	Het
Tchh	A	T	3: 93,444,112	Q286H	unknown	Het
Tmem184c	A	T	8: 77,604,723	Y172*	probably null	Het
Tsc22d1	T	G	14: 76,418,826	M833R	possibly damaging	Het
Ugt1a7c	G	T	1: 88,095,879	L253F	probably damaging	Het
Usp19	C	T	9: 108,492,567		probably benign	Het
Xirp2	T	A	2: 67,524,804	I3303K	possibly damaging	Het
Zfp574	G	A	7: 25,080,332	A260T	probably benign	Het
Zswim6	A	G	13: 107,744,107		noncoding transcript	Het

Other mutations in Kcnh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Kcnh3	APN	15	99242473	missense	possibly damaging	0.85
IGL00911:Kcnh3	APN	15	99233001	nonsense	probably null
IGL01099:Kcnh3	APN	15	99239736	missense	probably benign	0.02
IGL01350:Kcnh3	APN	15	99241992	missense	probably benign
IGL01375:Kcnh3	APN	15	99226993	nonsense	probably null
IGL01611:Kcnh3	APN	15	99229502	missense	probably benign	0.04
IGL01920:Kcnh3	APN	15	99233377	missense	probably benign	0.16
IGL02282:Kcnh3	APN	15	99228043	critical splice donor site	probably null
IGL02581:Kcnh3	APN	15	99238171	missense	possibly damaging	0.72
IGL02889:Kcnh3	APN	15	99227110	missense	probably null	0.82
R0427:Kcnh3	UTSW	15	99233299	missense	probably benign	0.22
R0532:Kcnh3	UTSW	15	99232963	missense	probably damaging	1.00
R0538:Kcnh3	UTSW	15	99240958	missense	probably benign	0.00
R0552:Kcnh3	UTSW	15	99229456	missense	probably damaging	1.00
R1235:Kcnh3	UTSW	15	99242103	splice site	probably null
R1290:Kcnh3	UTSW	15	99227120	splice site	probably null
R1499:Kcnh3	UTSW	15	99239915	missense	probably benign	0.00
R1517:Kcnh3	UTSW	15	99238209	missense	probably damaging	1.00
R1706:Kcnh3	UTSW	15	99238078	missense	possibly damaging	0.86
R1973:Kcnh3	UTSW	15	99229400	missense	probably damaging	1.00
R2285:Kcnh3	UTSW	15	99241992	missense	probably benign
R3196:Kcnh3	UTSW	15	99233981	missense	probably damaging	1.00
R3716:Kcnh3	UTSW	15	99232765	missense	possibly damaging	0.52
R4619:Kcnh3	UTSW	15	99234101	missense	probably damaging	1.00
R4620:Kcnh3	UTSW	15	99234101	missense	probably damaging	1.00
R4624:Kcnh3	UTSW	15	99226372	missense	probably damaging	1.00
R4701:Kcnh3	UTSW	15	99241945	missense	probably benign
R4853:Kcnh3	UTSW	15	99242089	missense	possibly damaging	0.56
R4869:Kcnh3	UTSW	15	99242032	missense	probably benign	0.06
R4991:Kcnh3	UTSW	15	99232756	missense	probably benign	0.00
R5004:Kcnh3	UTSW	15	99226502	nonsense	probably null
R5296:Kcnh3	UTSW	15	99241939	missense	probably null	0.92
R5317:Kcnh3	UTSW	15	99227941	missense	probably benign
R5338:Kcnh3	UTSW	15	99242394	nonsense	probably null
R5658:Kcnh3	UTSW	15	99242076	missense	possibly damaging	0.77
R5794:Kcnh3	UTSW	15	99232974	missense	probably benign	0.01
R6303:Kcnh3	UTSW	15	99227038	missense	probably benign	0.37
R6304:Kcnh3	UTSW	15	99227038	missense	probably benign	0.37
R6385:Kcnh3	UTSW	15	99227941	missense	probably benign
R6466:Kcnh3	UTSW	15	99238243	missense	probably damaging	1.00
R6640:Kcnh3	UTSW	15	99241768	missense	probably benign	0.08
R6879:Kcnh3	UTSW	15	99238167	missense	probably damaging	1.00
R6984:Kcnh3	UTSW	15	99228552	missense	probably benign	0.00
R7770:Kcnh3	UTSW	15	99233266	missense	probably damaging	1.00
R8354:Kcnh3	UTSW	15	99229330	missense	probably damaging	1.00
R8427:Kcnh3	UTSW	15	99227053	missense	probably benign	0.00
R8486:Kcnh3	UTSW	15	99238210	missense	probably damaging	1.00
RF006:Kcnh3	UTSW	15	99239928	critical splice donor site	probably null
X0028:Kcnh3	UTSW	15	99242100	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGTGGTCTACTGCTCCGATG -3'
(R):5'- AGACACACTGACATGGGGTG -3'

Sequencing Primer
(F):5'- GCTCCGATGGCTTCTGTGAC -3'
(R):5'- TCCCCCTTCTGAATATGAGAAACTGG -3'

Posted On

2017-02-28