Incidental Mutation 'R5935:Scn3a'
ID462149
Institutional Source Beutler Lab
Gene Symbol Scn3a
Ensembl Gene ENSMUSG00000057182
Gene Namesodium channel, voltage-gated, type III, alpha
SynonymsNav1.3, LOC381367
MMRRC Submission 044129-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5935 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location65457118-65567627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65464836 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1514 (N1514K)
Ref Sequence ENSEMBL: ENSMUSP00000097647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066432] [ENSMUST00000100069]
Predicted Effect probably damaging
Transcript: ENSMUST00000066432
AA Change: N1514K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065023
Gene: ENSMUSG00000057182
AA Change: N1514K

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100069
AA Change: N1514K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097647
Gene: ENSMUSG00000057182
AA Change: N1514K

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Meta Mutation Damage Score 0.9261 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (92/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality of most mutants by weaning. Heterozygous mice exhibit improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,465 L230P probably benign Het
6430531B16Rik G A 7: 139,976,613 H154Y probably benign Het
Adam26b C G 8: 43,521,298 M222I probably benign Het
Ahnak T C 19: 9,015,182 V4610A possibly damaging Het
Ankrd13c C T 3: 157,947,583 silent Het
Cables2 A G 2: 180,262,048 probably benign Het
Cabp2 C A 19: 4,086,497 A181D probably damaging Het
Camsap3 A G 8: 3,601,999 D265G probably damaging Het
Cbs G T 17: 31,632,879 T50N probably damaging Het
Ccdc129 A T 6: 55,897,769 R235* probably null Het
Cenpa A T 5: 30,673,037 Q83L possibly damaging Het
Cit A T 5: 115,925,539 probably benign Het
Ckap5 A G 2: 91,615,100 E1694G possibly damaging Het
Copz1 A T 15: 103,294,770 M104L probably benign Het
Crot T A 5: 8,974,192 M335L probably benign Het
Ctnna2 T C 6: 77,143,921 D373G probably benign Het
Ctu2 G A 8: 122,476,954 probably benign Het
Cyp3a59 T A 5: 146,090,645 Y75* probably null Het
Dbi A G 1: 120,120,853 I21T probably benign Het
Dcun1d3 A G 7: 119,859,576 S79P probably benign Het
Dock10 T A 1: 80,505,587 probably benign Het
Dstyk T A 1: 132,454,137 I543N probably damaging Het
Epx G T 11: 87,865,492 A621E probably damaging Het
Farp2 G A 1: 93,620,645 probably null Het
Gm11992 C T 11: 9,052,711 P25S probably damaging Het
Grik5 A T 7: 25,059,077 M307K possibly damaging Het
Hnf1b A T 11: 83,882,677 N234I probably damaging Het
Htr2a A G 14: 74,645,090 D172G probably damaging Het
Ifit1bl2 T C 19: 34,619,728 T163A probably benign Het
Igsf10 A T 3: 59,328,157 D1534E probably benign Het
Il3ra T G 14: 14,350,799 V178G probably damaging Het
Itgb1 A T 8: 128,713,237 K136* probably null Het
Lama2 T A 10: 27,015,498 I2540F probably benign Het
Lrp8 C A 4: 107,857,296 H622Q probably damaging Het
Lrrc2 T A 9: 110,966,561 M138K probably benign Het
Lrrk2 C A 15: 91,745,831 H1242N probably benign Het
Lsm11 G C 11: 45,944,618 R99G probably benign Het
Mif4gd C T 11: 115,609,613 V40M probably benign Het
Mpp3 A T 11: 102,025,415 V37D probably damaging Het
Mre11a T A 9: 14,786,962 D35E probably damaging Het
Mroh4 C A 15: 74,621,154 V233F probably damaging Het
Npy2r A T 3: 82,540,761 S123T possibly damaging Het
Nrip2 A G 6: 128,408,398 Y264C possibly damaging Het
Obscn A G 11: 59,006,813 S6639P unknown Het
Olfr574 T A 7: 102,948,810 F105Y probably benign Het
Olfr963 C T 9: 39,669,090 T11I probably benign Het
Osbpl5 C T 7: 143,756,958 probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pcdhb8 A G 18: 37,356,190 D307G probably damaging Het
Pde1b A G 15: 103,521,439 K120E possibly damaging Het
Pdzrn4 T C 15: 92,397,374 S154P probably benign Het
Ppp1r13b T C 12: 111,830,442 K889R probably benign Het
Ppp4r3a T A 12: 101,051,613 D439V probably damaging Het
Ptk2b A G 14: 66,173,879 I401T probably damaging Het
Rab24 T C 13: 55,320,530 T153A probably damaging Het
Rarb C A 14: 16,434,264 A305S probably damaging Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Scn10a G A 9: 119,627,171 T1194I probably damaging Het
Serpinb3d T C 1: 107,083,375 T36A probably benign Het
Shisa5 T A 9: 109,056,683 M229K possibly damaging Het
Sik2 C T 9: 50,917,131 G204R probably damaging Het
Sla C T 15: 66,793,705 G46E probably damaging Het
Slc35g3 A T 11: 69,761,683 M1K probably null Het
Slc5a7 A T 17: 54,276,944 Y439* probably null Het
Slc9a1 T C 4: 133,419,865 probably benign Het
Slitrk6 T G 14: 110,749,873 T801P probably benign Het
Spata31d1c T C 13: 65,037,080 V812A possibly damaging Het
Sphkap A C 1: 83,339,599 L59R probably damaging Het
Srsf10 C A 4: 135,856,242 R6S probably damaging Het
Supt5 T A 7: 28,329,475 R131S probably benign Het
Syne1 T C 10: 5,360,706 probably null Het
Tepp A T 8: 95,319,992 T98S possibly damaging Het
Tet2 T A 3: 133,488,535 H46L possibly damaging Het
Tnfsf4 T A 1: 161,417,248 N169K probably damaging Het
Tprg A T 16: 25,317,261 M1L possibly damaging Het
Tsen2 A G 6: 115,559,595 Y104C probably damaging Het
Ttc6 A G 12: 57,673,804 Y952C probably damaging Het
Umod A T 7: 119,471,427 I414N probably damaging Het
Usp10 G T 8: 119,947,089 V398L possibly damaging Het
Vmn2r23 A T 6: 123,741,895 I736F possibly damaging Het
Vmn2r65 C A 7: 84,943,661 G446V probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Yars2 A G 16: 16,309,471 I467V probably benign Het
Ykt6 A G 11: 5,959,338 E49G possibly damaging Het
Zan T A 5: 137,443,930 M1907L unknown Het
Zdhhc2 T C 8: 40,464,236 S225P probably damaging Het
Zfc3h1 A T 10: 115,431,357 probably benign Het
Other mutations in Scn3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Scn3a APN 2 65497392 missense probably benign 0.05
IGL01086:Scn3a APN 2 65470159 missense probably benign 0.27
IGL01141:Scn3a APN 2 65495113 missense possibly damaging 0.73
IGL01150:Scn3a APN 2 65497365 splice site probably null
IGL01564:Scn3a APN 2 65461446 missense probably damaging 1.00
IGL01594:Scn3a APN 2 65461431 missense probably damaging 1.00
IGL01751:Scn3a APN 2 65461252 missense possibly damaging 0.87
IGL01803:Scn3a APN 2 65521783 unclassified probably benign
IGL01822:Scn3a APN 2 65495264 missense probably damaging 1.00
IGL02063:Scn3a APN 2 65461510 missense probably damaging 1.00
IGL02142:Scn3a APN 2 65526621 missense possibly damaging 0.95
IGL02198:Scn3a APN 2 65508489 missense probably benign 0.12
IGL02501:Scn3a APN 2 65526555 missense possibly damaging 0.82
IGL02608:Scn3a APN 2 65524166 nonsense probably null
IGL02645:Scn3a APN 2 65514527 missense probably benign 0.12
IGL02653:Scn3a APN 2 65461187 missense probably damaging 1.00
IGL03077:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03099:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03299:Scn3a APN 2 65497516 missense probably benign 0.01
IGL03327:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03346:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03355:Scn3a APN 2 65460568 missense possibly damaging 0.91
curtsey UTSW 2 65464836 missense probably damaging 1.00
dip UTSW 2 65524179 missense probably benign 0.01
Regime UTSW 2 65524850 missense possibly damaging 0.93
Willpower UTSW 2 65525754 missense possibly damaging 0.92
R0019:Scn3a UTSW 2 65461701 missense probably damaging 1.00
R0316:Scn3a UTSW 2 65460829 missense probably damaging 1.00
R0374:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R0414:Scn3a UTSW 2 65525982 splice site probably benign
R0609:Scn3a UTSW 2 65536510 missense probably damaging 0.96
R0613:Scn3a UTSW 2 65472284 missense possibly damaging 0.92
R0645:Scn3a UTSW 2 65524850 missense possibly damaging 0.93
R0665:Scn3a UTSW 2 65484411 missense probably null 0.00
R0667:Scn3a UTSW 2 65484411 missense probably null 0.00
R0710:Scn3a UTSW 2 65469046 missense probably damaging 0.99
R1202:Scn3a UTSW 2 65506147 missense probably benign 0.07
R1440:Scn3a UTSW 2 65529441 missense possibly damaging 0.95
R1447:Scn3a UTSW 2 65469980 missense probably damaging 1.00
R1564:Scn3a UTSW 2 65514635 missense probably damaging 0.98
R1595:Scn3a UTSW 2 65498979 missense probably damaging 0.99
R1775:Scn3a UTSW 2 65472342 missense probably damaging 1.00
R1781:Scn3a UTSW 2 65472385 missense probably damaging 1.00
R1822:Scn3a UTSW 2 65484372 missense probably damaging 1.00
R1924:Scn3a UTSW 2 65461534 missense probably damaging 1.00
R2061:Scn3a UTSW 2 65461308 missense probably damaging 1.00
R2070:Scn3a UTSW 2 65520866 missense possibly damaging 0.72
R2174:Scn3a UTSW 2 65507206 missense probably damaging 0.99
R2656:Scn3a UTSW 2 65526518 missense probably damaging 0.99
R2680:Scn3a UTSW 2 65536536 missense probably benign 0.04
R3882:Scn3a UTSW 2 65482279 missense probably benign 0.03
R4019:Scn3a UTSW 2 65525951 intron probably benign
R4106:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4108:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4109:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4225:Scn3a UTSW 2 65536427 missense probably damaging 0.99
R4419:Scn3a UTSW 2 65466960 missense probably damaging 1.00
R4552:Scn3a UTSW 2 65524179 missense probably benign 0.01
R4687:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R4780:Scn3a UTSW 2 65506193 missense probably damaging 1.00
R4820:Scn3a UTSW 2 65461278 missense probably damaging 1.00
R4856:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4886:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4914:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4915:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4918:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R5088:Scn3a UTSW 2 65472299 missense probably damaging 1.00
R5101:Scn3a UTSW 2 65461506 missense probably damaging 1.00
R5128:Scn3a UTSW 2 65508518 missense probably benign 0.08
R5132:Scn3a UTSW 2 65468204 missense probably benign 0.09
R5297:Scn3a UTSW 2 65469034 missense possibly damaging 0.83
R5595:Scn3a UTSW 2 65460713 missense probably benign
R5699:Scn3a UTSW 2 65507264 missense possibly damaging 0.54
R5730:Scn3a UTSW 2 65495260 missense probably benign 0.00
R5735:Scn3a UTSW 2 65482278 missense probably damaging 0.98
R5735:Scn3a UTSW 2 65484459 missense probably benign 0.09
R5855:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R5888:Scn3a UTSW 2 65497398 missense probably benign 0.06
R5898:Scn3a UTSW 2 65514695 missense probably damaging 0.96
R5970:Scn3a UTSW 2 65494781 intron probably benign
R6214:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6215:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6235:Scn3a UTSW 2 65461335 missense probably damaging 0.97
R6307:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R6355:Scn3a UTSW 2 65461299 missense probably damaging 0.99
R6376:Scn3a UTSW 2 65461499 missense possibly damaging 0.88
R6517:Scn3a UTSW 2 65497563 missense possibly damaging 0.73
R6775:Scn3a UTSW 2 65521815 missense possibly damaging 0.82
R6893:Scn3a UTSW 2 65525754 missense possibly damaging 0.92
R6986:Scn3a UTSW 2 65508618 missense probably damaging 0.97
R7065:Scn3a UTSW 2 65464855 missense probably benign
R7078:Scn3a UTSW 2 65497600 missense probably damaging 1.00
R7146:Scn3a UTSW 2 65483142 missense probably damaging 1.00
R7240:Scn3a UTSW 2 65469042 missense possibly damaging 0.77
R7294:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R7352:Scn3a UTSW 2 65525701 missense possibly damaging 0.51
R7636:Scn3a UTSW 2 65497689 missense probably damaging 1.00
R7708:Scn3a UTSW 2 65483168 missense possibly damaging 0.47
R7733:Scn3a UTSW 2 65508650 missense probably benign 0.08
R7761:Scn3a UTSW 2 65529454 missense possibly damaging 0.95
R7792:Scn3a UTSW 2 65466990 nonsense probably null
R7828:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R7875:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7884:Scn3a UTSW 2 65536515 missense probably damaging 0.96
R7958:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7967:Scn3a UTSW 2 65536515 missense probably damaging 0.96
X0062:Scn3a UTSW 2 65467001 missense probably damaging 0.98
X0062:Scn3a UTSW 2 65524847 nonsense probably null
Z1177:Scn3a UTSW 2 65498892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTTCTATGTCAAACTGCAGGC -3'
(R):5'- ACCCCTGATGATGCCATGTG -3'

Sequencing Primer
(F):5'- CAGGAAGTGGGGAAAAGAGTCTCTC -3'
(R):5'- TGTGCACACTAACCCTACCTC -3'
Posted On2017-02-28