Incidental Mutation 'R0567:Usp17le'
Institutional Source Beutler Lab
Gene Symbol Usp17le
Ensembl Gene ENSMUSG00000043073
Gene Nameubiquitin specific peptidase 17-like E
SynonymsGm6596, Dub3
MMRRC Submission 038758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0567 (G1)
Quality Score225
Status Not validated
Chromosomal Location104768049-104777470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104768898 bp
Amino Acid Change Valine to Isoleucine at position 346 (V346I)
Ref Sequence ENSEMBL: ENSMUSP00000147776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053464] [ENSMUST00000211384]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053464
AA Change: V346I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051716
Gene: ENSMUSG00000043073
AA Change: V346I

Pfam:UCH 84 379 9e-54 PFAM
Pfam:UCH_1 85 362 2.3e-21 PFAM
low complexity region 408 417 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000211384
AA Change: V346I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,228,016 E303G probably damaging Het
Akr1b3 A T 6: 34,304,345 probably null Het
Alox8 A T 11: 69,191,522 probably null Het
Apcdd1 G A 18: 62,934,036 E74K possibly damaging Het
Atr T C 9: 95,865,829 V388A probably benign Het
AW554918 G A 18: 25,400,035 E452K possibly damaging Het
C1galt1 A G 6: 7,866,874 D240G probably damaging Het
Ccdc130 A G 8: 84,260,665 L93P probably damaging Het
Ceacam10 T A 7: 24,778,409 D116E probably damaging Het
Col15a1 G T 4: 47,293,231 V912L possibly damaging Het
Cyp3a11 G A 5: 145,869,149 T136I probably damaging Het
Denr C T 5: 123,908,158 T17M probably benign Het
Doc2b A G 11: 75,780,124 F227S probably damaging Het
Dsp A T 13: 38,192,438 T1400S probably benign Het
Egfr A T 11: 16,872,873 D412V probably benign Het
Fryl C T 5: 73,065,391 G1949D possibly damaging Het
Gstp3 A T 19: 4,057,636 L176Q possibly damaging Het
Heatr5a T A 12: 51,910,089 N1075I probably damaging Het
Hist1h2ah T C 13: 22,035,564 probably benign Het
Ighv1-69 C T 12: 115,623,549 probably benign Het
Lama3 A G 18: 12,549,252 I1092V probably benign Het
Lipg A T 18: 74,957,369 H36Q probably benign Het
Myh7b T C 2: 155,626,398 W836R probably damaging Het
Oit3 A T 10: 59,435,978 C186S probably damaging Het
Olfr734 A T 14: 50,320,658 M59K probably damaging Het
P2ry2 T C 7: 100,998,541 T186A probably damaging Het
Pyroxd2 T C 19: 42,735,925 T300A probably benign Het
Rab26 C A 17: 24,529,582 V283F probably damaging Het
Rad50 C T 11: 53,654,956 R1180Q probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Shroom3 A G 5: 92,964,453 D1891G possibly damaging Het
Syne2 G A 12: 75,890,230 E201K probably damaging Het
Taf6 A T 5: 138,183,726 probably null Het
Tbc1d32 A T 10: 56,173,963 M493K possibly damaging Het
Uaca A G 9: 60,871,381 T1017A probably benign Het
Vmn1r71 T C 7: 10,748,629 D44G probably damaging Het
Vmn2r80 A G 10: 79,194,831 I830M possibly damaging Het
Zfp994 T C 17: 22,200,468 Y500C possibly damaging Het
Zscan20 A G 4: 128,589,450 probably null Het
Other mutations in Usp17le
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Usp17le APN 7 104768787 missense probably benign 0.00
IGL01974:Usp17le APN 7 104768435 missense probably benign
IGL02364:Usp17le APN 7 104768775 nonsense probably null
IGL02413:Usp17le APN 7 104769726 missense probably benign 0.39
IGL02433:Usp17le APN 7 104769201 missense probably benign 0.01
IGL02960:Usp17le APN 7 104768740 missense probably benign
IGL02984:Usp17le UTSW 7 104769104 missense probably benign 0.21
R0035:Usp17le UTSW 7 104769062 nonsense probably null
R0389:Usp17le UTSW 7 104768460 missense probably damaging 0.96
R0499:Usp17le UTSW 7 104768501 missense probably benign 0.02
R0879:Usp17le UTSW 7 104769647 missense probably damaging 0.99
R0879:Usp17le UTSW 7 104769648 missense possibly damaging 0.46
R4840:Usp17le UTSW 7 104769770 missense probably benign 0.34
R5140:Usp17le UTSW 7 104769438 missense probably damaging 1.00
R5403:Usp17le UTSW 7 104769234 missense probably damaging 1.00
R6210:Usp17le UTSW 7 104769143 missense probably damaging 1.00
R7047:Usp17le UTSW 7 104768433 missense probably benign 0.02
R7157:Usp17le UTSW 7 104768489 missense probably benign 0.03
R7361:Usp17le UTSW 7 104768877 missense probably damaging 1.00
R7386:Usp17le UTSW 7 104768307 splice site probably null
R7997:Usp17le UTSW 7 104768839 missense possibly damaging 0.94
R8189:Usp17le UTSW 7 104769348 missense probably damaging 0.99
R8248:Usp17le UTSW 7 104769794 missense possibly damaging 0.92
Predicted Primers PCR Primer

Sequencing Primer
Posted On2013-06-11