Incidental Mutation 'R5935:Cit'
ID462163
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Namecitron
SynonymsCRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase
MMRRC Submission 044129-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R5935 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115845278-116008947 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 115925539 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]
Predicted Effect probably benign
Transcript: ENSMUST00000051704
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102560
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112008
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128702
Predicted Effect probably benign
Transcript: ENSMUST00000141101
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147479
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (92/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,465 L230P probably benign Het
6430531B16Rik G A 7: 139,976,613 H154Y probably benign Het
Adam26b C G 8: 43,521,298 M222I probably benign Het
Ahnak T C 19: 9,015,182 V4610A possibly damaging Het
Ankrd13c C T 3: 157,947,583 silent Het
Cables2 A G 2: 180,262,048 probably benign Het
Cabp2 C A 19: 4,086,497 A181D probably damaging Het
Camsap3 A G 8: 3,601,999 D265G probably damaging Het
Cbs G T 17: 31,632,879 T50N probably damaging Het
Ccdc129 A T 6: 55,897,769 R235* probably null Het
Cenpa A T 5: 30,673,037 Q83L possibly damaging Het
Ckap5 A G 2: 91,615,100 E1694G possibly damaging Het
Copz1 A T 15: 103,294,770 M104L probably benign Het
Crot T A 5: 8,974,192 M335L probably benign Het
Ctnna2 T C 6: 77,143,921 D373G probably benign Het
Ctu2 G A 8: 122,476,954 probably benign Het
Cyp3a59 T A 5: 146,090,645 Y75* probably null Het
Dbi A G 1: 120,120,853 I21T probably benign Het
Dcun1d3 A G 7: 119,859,576 S79P probably benign Het
Dock10 T A 1: 80,505,587 probably benign Het
Dstyk T A 1: 132,454,137 I543N probably damaging Het
Epx G T 11: 87,865,492 A621E probably damaging Het
Farp2 G A 1: 93,620,645 probably null Het
Gm11992 C T 11: 9,052,711 P25S probably damaging Het
Grik5 A T 7: 25,059,077 M307K possibly damaging Het
Hnf1b A T 11: 83,882,677 N234I probably damaging Het
Htr2a A G 14: 74,645,090 D172G probably damaging Het
Ifit1bl2 T C 19: 34,619,728 T163A probably benign Het
Igsf10 A T 3: 59,328,157 D1534E probably benign Het
Il3ra T G 14: 14,350,799 V178G probably damaging Het
Itgb1 A T 8: 128,713,237 K136* probably null Het
Lama2 T A 10: 27,015,498 I2540F probably benign Het
Lrp8 C A 4: 107,857,296 H622Q probably damaging Het
Lrrc2 T A 9: 110,966,561 M138K probably benign Het
Lrrk2 C A 15: 91,745,831 H1242N probably benign Het
Lsm11 G C 11: 45,944,618 R99G probably benign Het
Mif4gd C T 11: 115,609,613 V40M probably benign Het
Mpp3 A T 11: 102,025,415 V37D probably damaging Het
Mre11a T A 9: 14,786,962 D35E probably damaging Het
Mroh4 C A 15: 74,621,154 V233F probably damaging Het
Npy2r A T 3: 82,540,761 S123T possibly damaging Het
Nrip2 A G 6: 128,408,398 Y264C possibly damaging Het
Obscn A G 11: 59,006,813 S6639P unknown Het
Olfr574 T A 7: 102,948,810 F105Y probably benign Het
Olfr963 C T 9: 39,669,090 T11I probably benign Het
Osbpl5 C T 7: 143,756,958 probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pcdhb8 A G 18: 37,356,190 D307G probably damaging Het
Pde1b A G 15: 103,521,439 K120E possibly damaging Het
Pdzrn4 T C 15: 92,397,374 S154P probably benign Het
Ppp1r13b T C 12: 111,830,442 K889R probably benign Het
Ppp4r3a T A 12: 101,051,613 D439V probably damaging Het
Ptk2b A G 14: 66,173,879 I401T probably damaging Het
Rab24 T C 13: 55,320,530 T153A probably damaging Het
Rarb C A 14: 16,434,264 A305S probably damaging Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Scn10a G A 9: 119,627,171 T1194I probably damaging Het
Scn3a G T 2: 65,464,836 N1514K probably damaging Het
Serpinb3d T C 1: 107,083,375 T36A probably benign Het
Shisa5 T A 9: 109,056,683 M229K possibly damaging Het
Sik2 C T 9: 50,917,131 G204R probably damaging Het
Sla C T 15: 66,793,705 G46E probably damaging Het
Slc35g3 A T 11: 69,761,683 M1K probably null Het
Slc5a7 A T 17: 54,276,944 Y439* probably null Het
Slc9a1 T C 4: 133,419,865 probably benign Het
Slitrk6 T G 14: 110,749,873 T801P probably benign Het
Spata31d1c T C 13: 65,037,080 V812A possibly damaging Het
Sphkap A C 1: 83,339,599 L59R probably damaging Het
Srsf10 C A 4: 135,856,242 R6S probably damaging Het
Supt5 T A 7: 28,329,475 R131S probably benign Het
Syne1 T C 10: 5,360,706 probably null Het
Tepp A T 8: 95,319,992 T98S possibly damaging Het
Tet2 T A 3: 133,488,535 H46L possibly damaging Het
Tnfsf4 T A 1: 161,417,248 N169K probably damaging Het
Tprg A T 16: 25,317,261 M1L possibly damaging Het
Tsen2 A G 6: 115,559,595 Y104C probably damaging Het
Ttc6 A G 12: 57,673,804 Y952C probably damaging Het
Umod A T 7: 119,471,427 I414N probably damaging Het
Usp10 G T 8: 119,947,089 V398L possibly damaging Het
Vmn2r23 A T 6: 123,741,895 I736F possibly damaging Het
Vmn2r65 C A 7: 84,943,661 G446V probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Yars2 A G 16: 16,309,471 I467V probably benign Het
Ykt6 A G 11: 5,959,338 E49G possibly damaging Het
Zan T A 5: 137,443,930 M1907L unknown Het
Zdhhc2 T C 8: 40,464,236 S225P probably damaging Het
Zfc3h1 A T 10: 115,431,357 probably benign Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115846465 missense probably damaging 0.99
IGL00482:Cit APN 5 115938755 missense probably damaging 0.97
IGL01317:Cit APN 5 115908716 missense probably benign 0.03
IGL01335:Cit APN 5 115908830 splice site probably benign
IGL01415:Cit APN 5 115941903 missense possibly damaging 0.78
IGL01447:Cit APN 5 115873843 splice site probably benign
IGL01537:Cit APN 5 115933854 missense probably benign 0.00
IGL01621:Cit APN 5 115992603 splice site probably benign
IGL02010:Cit APN 5 115875947 missense probably damaging 1.00
IGL02538:Cit APN 5 115986989 nonsense probably null
IGL02607:Cit APN 5 115859209 missense probably benign
IGL02720:Cit APN 5 115995452 missense probably benign 0.26
IGL02725:Cit APN 5 115985473 missense probably benign 0.02
IGL02967:Cit APN 5 115945837 missense probably benign 0.11
IGL02973:Cit APN 5 116005999 missense possibly damaging 0.73
IGL03383:Cit APN 5 115873845 splice site probably benign
PIT4514001:Cit UTSW 5 115997854 critical splice donor site probably null
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0226:Cit UTSW 5 115984840 missense probably damaging 0.99
R0320:Cit UTSW 5 115979445 missense possibly damaging 0.87
R0401:Cit UTSW 5 115985479 missense probably benign 0.06
R0480:Cit UTSW 5 115933393 splice site probably benign
R0609:Cit UTSW 5 115873943 missense probably damaging 0.98
R0737:Cit UTSW 5 115946919 missense probably damaging 1.00
R1238:Cit UTSW 5 115851221 missense probably benign 0.30
R1503:Cit UTSW 5 115873900 missense possibly damaging 0.94
R1551:Cit UTSW 5 115945842 missense probably benign 0.00
R1602:Cit UTSW 5 115997730 missense probably damaging 1.00
R1720:Cit UTSW 5 115967897 missense probably damaging 0.98
R1854:Cit UTSW 5 115873901 missense probably damaging 1.00
R1886:Cit UTSW 5 115933486 missense probably damaging 1.00
R2024:Cit UTSW 5 115947924 missense probably damaging 0.97
R2024:Cit UTSW 5 116005840 missense probably damaging 0.97
R2048:Cit UTSW 5 115886813 splice site probably null
R2128:Cit UTSW 5 115985507 missense possibly damaging 0.63
R2192:Cit UTSW 5 115968009 missense probably benign 0.00
R2244:Cit UTSW 5 115926505 missense probably damaging 1.00
R2518:Cit UTSW 5 115987046 missense probably damaging 0.99
R2679:Cit UTSW 5 115969115 missense probably benign 0.00
R2898:Cit UTSW 5 115873978 unclassified probably null
R2908:Cit UTSW 5 115981676 missense probably benign 0.00
R3079:Cit UTSW 5 115925486 missense probably damaging 0.97
R3779:Cit UTSW 5 115859341 missense probably benign 0.01
R4081:Cit UTSW 5 115948050 missense probably damaging 1.00
R4494:Cit UTSW 5 115873984 missense probably damaging 1.00
R4610:Cit UTSW 5 115994087 missense probably benign 0.01
R4757:Cit UTSW 5 115997549 missense probably damaging 1.00
R4788:Cit UTSW 5 115933506 missense probably damaging 1.00
R4816:Cit UTSW 5 115908691 missense probably damaging 1.00
R4890:Cit UTSW 5 115988123 intron probably benign
R4899:Cit UTSW 5 115863028 missense possibly damaging 0.60
R4928:Cit UTSW 5 115985797 missense probably benign 0.00
R5073:Cit UTSW 5 115946843 missense probably benign 0.24
R5151:Cit UTSW 5 115979835 missense probably damaging 1.00
R5154:Cit UTSW 5 115988405 missense probably damaging 1.00
R5222:Cit UTSW 5 115952543 missense probably benign 0.03
R5814:Cit UTSW 5 115979419 missense probably damaging 1.00
R5946:Cit UTSW 5 115997534 missense probably damaging 1.00
R6051:Cit UTSW 5 115846405 missense probably benign
R6289:Cit UTSW 5 116006326 makesense probably null
R6298:Cit UTSW 5 115948065 missense probably damaging 1.00
R6362:Cit UTSW 5 115886676 missense probably benign 0.01
R6545:Cit UTSW 5 115846434 missense probably null 0.00
R6761:Cit UTSW 5 115908675 missense probably damaging 1.00
R6798:Cit UTSW 5 115926526 missense possibly damaging 0.56
R6814:Cit UTSW 5 115884963 missense probably damaging 1.00
R6825:Cit UTSW 5 115981774 missense probably damaging 0.99
R6845:Cit UTSW 5 115984888 missense probably damaging 1.00
R6983:Cit UTSW 5 115994091 missense probably damaging 1.00
R7164:Cit UTSW 5 115985787 missense possibly damaging 0.94
R7359:Cit UTSW 5 115926574 missense probably damaging 1.00
R7597:Cit UTSW 5 115886681 nonsense probably null
R7729:Cit UTSW 5 115984822 missense possibly damaging 0.87
R7763:Cit UTSW 5 115987001 missense probably benign 0.01
R7786:Cit UTSW 5 115863018 missense probably benign 0.00
R7799:Cit UTSW 5 115862968 missense probably benign 0.00
R8060:Cit UTSW 5 115908727 missense probably benign 0.00
R8068:Cit UTSW 5 115952466 missense probably damaging 1.00
R8068:Cit UTSW 5 115982235 missense probably benign 0.03
Z1088:Cit UTSW 5 115985533 missense possibly damaging 0.62
Z1176:Cit UTSW 5 115986603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCCATGCTAACCACGCAG -3'
(R):5'- CTGGGTCATGCTGAGAAACG -3'

Sequencing Primer
(F):5'- GCTAACCACGCAGACCACTTG -3'
(R):5'- CATGCTGAGAAACGGGCCG -3'
Posted On2017-02-28