Incidental Mutation 'R5935:Vmn2r23'
ID 462169
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 044129-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R5935 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123718854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 736 (I736F)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158091
Predicted Effect possibly damaging
Transcript: ENSMUST00000172391
AA Change: I736F

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: I736F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (92/96)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b C G 8: 43,974,335 (GRCm39) M222I probably benign Het
Ahnak T C 19: 8,992,546 (GRCm39) V4610A possibly damaging Het
Ankrd13c C T 3: 157,653,220 (GRCm39) silent Het
Cables2 A G 2: 179,903,841 (GRCm39) probably benign Het
Cabp2 C A 19: 4,136,497 (GRCm39) A181D probably damaging Het
Camsap3 A G 8: 3,651,999 (GRCm39) D265G probably damaging Het
Cbs G T 17: 31,851,853 (GRCm39) T50N probably damaging Het
Cenpa A T 5: 30,830,381 (GRCm39) Q83L possibly damaging Het
Cit A T 5: 116,063,598 (GRCm39) probably benign Het
Ckap5 A G 2: 91,445,445 (GRCm39) E1694G possibly damaging Het
Copz1 A T 15: 103,203,197 (GRCm39) M104L probably benign Het
Crot T A 5: 9,024,192 (GRCm39) M335L probably benign Het
Ctnna2 T C 6: 77,120,904 (GRCm39) D373G probably benign Het
Ctu2 G A 8: 123,203,693 (GRCm39) probably benign Het
Cyp3a59 T A 5: 146,027,455 (GRCm39) Y75* probably null Het
Dbi A G 1: 120,048,583 (GRCm39) I21T probably benign Het
Dcun1d3 A G 7: 119,458,799 (GRCm39) S79P probably benign Het
Dock10 T A 1: 80,483,304 (GRCm39) probably benign Het
Dstyk T A 1: 132,381,875 (GRCm39) I543N probably damaging Het
Epx G T 11: 87,756,318 (GRCm39) A621E probably damaging Het
Farp2 G A 1: 93,548,367 (GRCm39) probably null Het
Gm11992 C T 11: 9,002,711 (GRCm39) P25S probably damaging Het
Grik5 A T 7: 24,758,502 (GRCm39) M307K possibly damaging Het
Hnf1b A T 11: 83,773,503 (GRCm39) N234I probably damaging Het
Htr2a A G 14: 74,882,530 (GRCm39) D172G probably damaging Het
Ifit1bl2 T C 19: 34,597,128 (GRCm39) T163A probably benign Het
Igsf10 A T 3: 59,235,578 (GRCm39) D1534E probably benign Het
Il3ra T G 14: 14,350,799 (GRCm38) V178G probably damaging Het
Itgb1 A T 8: 129,439,718 (GRCm39) K136* probably null Het
Itprid1 A T 6: 55,874,754 (GRCm39) R235* probably null Het
Lama2 T A 10: 26,891,494 (GRCm39) I2540F probably benign Het
Lrp8 C A 4: 107,714,493 (GRCm39) H622Q probably damaging Het
Lrrc2 T A 9: 110,795,629 (GRCm39) M138K probably benign Het
Lrrk2 C A 15: 91,630,034 (GRCm39) H1242N probably benign Het
Lsm11 G C 11: 45,835,445 (GRCm39) R99G probably benign Het
Mif4gd C T 11: 115,500,439 (GRCm39) V40M probably benign Het
Mpp3 A T 11: 101,916,241 (GRCm39) V37D probably damaging Het
Mre11a T A 9: 14,698,258 (GRCm39) D35E probably damaging Het
Mroh4 C A 15: 74,493,003 (GRCm39) V233F probably damaging Het
Npy2r A T 3: 82,448,068 (GRCm39) S123T possibly damaging Het
Nrip2 A G 6: 128,385,361 (GRCm39) Y264C possibly damaging Het
Obscn A G 11: 58,897,639 (GRCm39) S6639P unknown Het
Or10d4 C T 9: 39,580,386 (GRCm39) T11I probably benign Het
Or51t4 T A 7: 102,598,017 (GRCm39) F105Y probably benign Het
Osbpl5 C T 7: 143,310,695 (GRCm39) probably benign Het
Panx1 A T 9: 14,921,513 (GRCm39) Y121N probably damaging Het
Pcdhb8 A G 18: 37,489,243 (GRCm39) D307G probably damaging Het
Pde1b A G 15: 103,429,866 (GRCm39) K120E possibly damaging Het
Pdzrn4 T C 15: 92,295,255 (GRCm39) S154P probably benign Het
Ppp1r13b T C 12: 111,796,876 (GRCm39) K889R probably benign Het
Ppp4r3a T A 12: 101,017,872 (GRCm39) D439V probably damaging Het
Ptk2b A G 14: 66,411,328 (GRCm39) I401T probably damaging Het
Rab24 T C 13: 55,468,343 (GRCm39) T153A probably damaging Het
Rarb C A 14: 16,434,264 (GRCm38) A305S probably damaging Het
Rc3h2 GCC GCCC 2: 37,304,745 (GRCm39) probably null Het
Scn10a G A 9: 119,456,237 (GRCm39) T1194I probably damaging Het
Scn3a G T 2: 65,295,180 (GRCm39) N1514K probably damaging Het
Serpinb3d T C 1: 107,011,105 (GRCm39) T36A probably benign Het
Shisa5 T A 9: 108,885,751 (GRCm39) M229K possibly damaging Het
Sik2 C T 9: 50,828,431 (GRCm39) G204R probably damaging Het
Sla C T 15: 66,665,554 (GRCm39) G46E probably damaging Het
Slc35g3 A T 11: 69,652,509 (GRCm39) M1K probably null Het
Slc5a7 A T 17: 54,583,972 (GRCm39) Y439* probably null Het
Slc9a1 T C 4: 133,147,176 (GRCm39) probably benign Het
Slitrk6 T G 14: 110,987,305 (GRCm39) T801P probably benign Het
Spata31d1c T C 13: 65,184,894 (GRCm39) V812A possibly damaging Het
Spata31g1 T C 4: 42,971,465 (GRCm39) L230P probably benign Het
Spef1l G A 7: 139,556,526 (GRCm39) H154Y probably benign Het
Sphkap A C 1: 83,317,320 (GRCm39) L59R probably damaging Het
Spmip8 A T 8: 96,046,620 (GRCm39) T98S possibly damaging Het
Srsf10 C A 4: 135,583,553 (GRCm39) R6S probably damaging Het
Supt5 T A 7: 28,028,900 (GRCm39) R131S probably benign Het
Syne1 T C 10: 5,310,706 (GRCm39) probably null Het
Tet2 T A 3: 133,194,296 (GRCm39) H46L possibly damaging Het
Tnfsf4 T A 1: 161,244,819 (GRCm39) N169K probably damaging Het
Tprg1 A T 16: 25,136,011 (GRCm39) M1L possibly damaging Het
Tsen2 A G 6: 115,536,556 (GRCm39) Y104C probably damaging Het
Ttc6 A G 12: 57,720,590 (GRCm39) Y952C probably damaging Het
Umod A T 7: 119,070,650 (GRCm39) I414N probably damaging Het
Usp10 G T 8: 120,673,828 (GRCm39) V398L possibly damaging Het
Vmn2r65 C A 7: 84,592,869 (GRCm39) G446V probably benign Het
Wbp1l C T 19: 46,642,619 (GRCm39) R191* probably null Het
Yars2 A G 16: 16,127,335 (GRCm39) I467V probably benign Het
Ykt6 A G 11: 5,909,338 (GRCm39) E49G possibly damaging Het
Zan T A 5: 137,442,192 (GRCm39) M1907L unknown Het
Zdhhc2 T C 8: 40,917,277 (GRCm39) S225P probably damaging Het
Zfc3h1 A T 10: 115,267,262 (GRCm39) probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGTGGCCTTCAAGTCCATC -3'
(R):5'- ACAGCCACCATGGTTTTGCC -3'

Sequencing Primer
(F):5'- GTGGCCTTCAAGTCCATCAAACC -3'
(R):5'- TGGGTATGAAAGAAATCCACACACTG -3'
Posted On 2017-02-28