Mutagenetix > Incidental Mutation

Incidental Mutation 'R0567:Oit3'

46221

Institutional Source

Beutler Lab

Gene Symbol

Oit3

Ensembl Gene

ENSMUSG00000009654

Gene Name

oncoprotein induced transcript 3

Synonyms

EF-9

MMRRC Submission

038758-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.382) question?

Stock #

R0567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59422958-59441778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59435978 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 186 (C186S)

Ref Sequence

ENSEMBL: ENSMUSP00000009798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009798]

AlphaFold

Q8R4V5

Predicted Effect

probably damaging
Transcript: ENSMUST00000009798
AA Change: C186S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: C186S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:ZP	50	144	9e-24	BLAST
EGF	150	181	2.16e1	SMART
EGF	185	222	2.94e-3	SMART
EGF	226	263	2.35e-2	SMART
ZP	267	516	2.74e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162493

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl1	A	G	4: 86,228,016	E303G	probably damaging	Het
Akr1b3	A	T	6: 34,304,345		probably null	Het
Alox8	A	T	11: 69,191,522		probably null	Het
Apcdd1	G	A	18: 62,934,036	E74K	possibly damaging	Het
Atr	T	C	9: 95,865,829	V388A	probably benign	Het
AW554918	G	A	18: 25,400,035	E452K	possibly damaging	Het
C1galt1	A	G	6: 7,866,874	D240G	probably damaging	Het
Ccdc130	A	G	8: 84,260,665	L93P	probably damaging	Het
Ceacam10	T	A	7: 24,778,409	D116E	probably damaging	Het
Col15a1	G	T	4: 47,293,231	V912L	possibly damaging	Het
Cyp3a11	G	A	5: 145,869,149	T136I	probably damaging	Het
Denr	C	T	5: 123,908,158	T17M	probably benign	Het
Doc2b	A	G	11: 75,780,124	F227S	probably damaging	Het
Dsp	A	T	13: 38,192,438	T1400S	probably benign	Het
Egfr	A	T	11: 16,872,873	D412V	probably benign	Het
Fryl	C	T	5: 73,065,391	G1949D	possibly damaging	Het
Gstp3	A	T	19: 4,057,636	L176Q	possibly damaging	Het
Heatr5a	T	A	12: 51,910,089	N1075I	probably damaging	Het
Hist1h2ah	T	C	13: 22,035,564		probably benign	Het
Ighv1-69	C	T	12: 115,623,549		probably benign	Het
Lama3	A	G	18: 12,549,252	I1092V	probably benign	Het
Lipg	A	T	18: 74,957,369	H36Q	probably benign	Het
Myh7b	T	C	2: 155,626,398	W836R	probably damaging	Het
Olfr734	A	T	14: 50,320,658	M59K	probably damaging	Het
P2ry2	T	C	7: 100,998,541	T186A	probably damaging	Het
Pyroxd2	T	C	19: 42,735,925	T300A	probably benign	Het
Rab26	C	A	17: 24,529,582	V283F	probably damaging	Het
Rad50	C	T	11: 53,654,956	R1180Q	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Shroom3	A	G	5: 92,964,453	D1891G	possibly damaging	Het
Syne2	G	A	12: 75,890,230	E201K	probably damaging	Het
Taf6	A	T	5: 138,183,726		probably null	Het
Tbc1d32	A	T	10: 56,173,963	M493K	possibly damaging	Het
Uaca	A	G	9: 60,871,381	T1017A	probably benign	Het
Usp17le	C	T	7: 104,768,898	V346I	possibly damaging	Het
Vmn1r71	T	C	7: 10,748,629	D44G	probably damaging	Het
Vmn2r80	A	G	10: 79,194,831	I830M	possibly damaging	Het
Zfp994	T	C	17: 22,200,468	Y500C	possibly damaging	Het
Zscan20	A	G	4: 128,589,450		probably null	Het

Other mutations in Oit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Oit3	APN	10	59425484	unclassified	probably benign
IGL01665:Oit3	APN	10	59438909	missense	probably damaging	1.00
IGL01839:Oit3	APN	10	59429496	missense	probably damaging	0.98
IGL02028:Oit3	APN	10	59438655	missense	probably damaging	0.98
PIT4585001:Oit3	UTSW	10	59431013	missense	possibly damaging	0.54
R0781:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1110:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1563:Oit3	UTSW	10	59428074	missense	probably damaging	1.00
R1623:Oit3	UTSW	10	59428239	missense	probably damaging	0.99
R1693:Oit3	UTSW	10	59425417	missense	probably damaging	1.00
R1754:Oit3	UTSW	10	59427940	splice site	probably null
R1853:Oit3	UTSW	10	59441622	critical splice donor site	probably null
R2070:Oit3	UTSW	10	59431013	missense	probably benign	0.03
R2211:Oit3	UTSW	10	59428070	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59428345	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59441685	start gained	probably benign
R3103:Oit3	UTSW	10	59438891	missense	probably damaging	0.98
R4414:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4415:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4416:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4417:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4584:Oit3	UTSW	10	59425462	missense	probably damaging	1.00
R4734:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4748:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4749:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R5070:Oit3	UTSW	10	59424027	missense	probably damaging	1.00
R5521:Oit3	UTSW	10	59435914	missense	probably benign
R6326:Oit3	UTSW	10	59428239	missense	probably damaging	1.00
R6490:Oit3	UTSW	10	59438552	missense	possibly damaging	0.92
R6526:Oit3	UTSW	10	59429640	missense	probably damaging	1.00
R6766:Oit3	UTSW	10	59438712	missense	probably damaging	0.99
R6921:Oit3	UTSW	10	59435945	missense	probably damaging	0.99
R7129:Oit3	UTSW	10	59428344	missense	probably damaging	0.99
R7440:Oit3	UTSW	10	59429570	missense	probably damaging	0.99
R7495:Oit3	UTSW	10	59423943	missense	possibly damaging	0.74
R7512:Oit3	UTSW	10	59438894	missense	probably damaging	1.00
R7866:Oit3	UTSW	10	59424030	missense	probably benign	0.03
R8312:Oit3	UTSW	10	59438810	missense	probably benign	0.01
R8321:Oit3	UTSW	10	59428160	missense	probably benign	0.00
R8919:Oit3	UTSW	10	59441646	missense	unknown
R9131:Oit3	UTSW	10	59435929	missense	probably benign	0.01
R9457:Oit3	UTSW	10	59441683	start codon destroyed	unknown
R9478:Oit3	UTSW	10	59438642	missense	probably damaging	0.99
R9502:Oit3	UTSW	10	59428351	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCAGCTTCCCAGATGTCAAAGAAC -3'
(R):5'- TTCTGCTTGGAGGTGACAGATGAAC -3'

Sequencing Primer
(F):5'- AGAACAAGCCAGTGGCTC -3'
(R):5'- AGTAGACAGATGAGCTAACAGC -3'

Posted On

2013-06-11