Mutagenetix > Incidental Mutation

Incidental Mutation 'R5935:Pdzrn4'

462219

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

044129-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R5935 (G1)

Quality Score

130

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92397374 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 154 (S154P)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000169942
AA Change: S154P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: S154P

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

96% (92/96)

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,971,465	L230P	probably benign	Het
6430531B16Rik	G	A	7: 139,976,613	H154Y	probably benign	Het
Adam26b	C	G	8: 43,521,298	M222I	probably benign	Het
Ahnak	T	C	19: 9,015,182	V4610A	possibly damaging	Het
Ankrd13c	C	T	3: 157,947,583		silent	Het
Cables2	A	G	2: 180,262,048		probably benign	Het
Cabp2	C	A	19: 4,086,497	A181D	probably damaging	Het
Camsap3	A	G	8: 3,601,999	D265G	probably damaging	Het
Cbs	G	T	17: 31,632,879	T50N	probably damaging	Het
Ccdc129	A	T	6: 55,897,769	R235*	probably null	Het
Cenpa	A	T	5: 30,673,037	Q83L	possibly damaging	Het
Cit	A	T	5: 115,925,539		probably benign	Het
Ckap5	A	G	2: 91,615,100	E1694G	possibly damaging	Het
Copz1	A	T	15: 103,294,770	M104L	probably benign	Het
Crot	T	A	5: 8,974,192	M335L	probably benign	Het
Ctnna2	T	C	6: 77,143,921	D373G	probably benign	Het
Ctu2	G	A	8: 122,476,954		probably benign	Het
Cyp3a59	T	A	5: 146,090,645	Y75*	probably null	Het
Dbi	A	G	1: 120,120,853	I21T	probably benign	Het
Dcun1d3	A	G	7: 119,859,576	S79P	probably benign	Het
Dock10	T	A	1: 80,505,587		probably benign	Het
Dstyk	T	A	1: 132,454,137	I543N	probably damaging	Het
Epx	G	T	11: 87,865,492	A621E	probably damaging	Het
Farp2	G	A	1: 93,620,645		probably null	Het
Gm11992	C	T	11: 9,052,711	P25S	probably damaging	Het
Grik5	A	T	7: 25,059,077	M307K	possibly damaging	Het
Hnf1b	A	T	11: 83,882,677	N234I	probably damaging	Het
Htr2a	A	G	14: 74,645,090	D172G	probably damaging	Het
Ifit1bl2	T	C	19: 34,619,728	T163A	probably benign	Het
Igsf10	A	T	3: 59,328,157	D1534E	probably benign	Het
Il3ra	T	G	14: 14,350,799	V178G	probably damaging	Het
Itgb1	A	T	8: 128,713,237	K136*	probably null	Het
Lama2	T	A	10: 27,015,498	I2540F	probably benign	Het
Lrp8	C	A	4: 107,857,296	H622Q	probably damaging	Het
Lrrc2	T	A	9: 110,966,561	M138K	probably benign	Het
Lrrk2	C	A	15: 91,745,831	H1242N	probably benign	Het
Lsm11	G	C	11: 45,944,618	R99G	probably benign	Het
Mif4gd	C	T	11: 115,609,613	V40M	probably benign	Het
Mpp3	A	T	11: 102,025,415	V37D	probably damaging	Het
Mre11a	T	A	9: 14,786,962	D35E	probably damaging	Het
Mroh4	C	A	15: 74,621,154	V233F	probably damaging	Het
Npy2r	A	T	3: 82,540,761	S123T	possibly damaging	Het
Nrip2	A	G	6: 128,408,398	Y264C	possibly damaging	Het
Obscn	A	G	11: 59,006,813	S6639P	unknown	Het
Olfr574	T	A	7: 102,948,810	F105Y	probably benign	Het
Olfr963	C	T	9: 39,669,090	T11I	probably benign	Het
Osbpl5	C	T	7: 143,756,958		probably benign	Het
Panx1	A	T	9: 15,010,217	Y121N	probably damaging	Het
Pcdhb8	A	G	18: 37,356,190	D307G	probably damaging	Het
Pde1b	A	G	15: 103,521,439	K120E	possibly damaging	Het
Ppp1r13b	T	C	12: 111,830,442	K889R	probably benign	Het
Ppp4r3a	T	A	12: 101,051,613	D439V	probably damaging	Het
Ptk2b	A	G	14: 66,173,879	I401T	probably damaging	Het
Rab24	T	C	13: 55,320,530	T153A	probably damaging	Het
Rarb	C	A	14: 16,434,264	A305S	probably damaging	Het
Rc3h2	GCC	GCCC	2: 37,414,733		probably null	Het
Scn10a	G	A	9: 119,627,171	T1194I	probably damaging	Het
Scn3a	G	T	2: 65,464,836	N1514K	probably damaging	Het
Serpinb3d	T	C	1: 107,083,375	T36A	probably benign	Het
Shisa5	T	A	9: 109,056,683	M229K	possibly damaging	Het
Sik2	C	T	9: 50,917,131	G204R	probably damaging	Het
Sla	C	T	15: 66,793,705	G46E	probably damaging	Het
Slc35g3	A	T	11: 69,761,683	M1K	probably null	Het
Slc5a7	A	T	17: 54,276,944	Y439*	probably null	Het
Slc9a1	T	C	4: 133,419,865		probably benign	Het
Slitrk6	T	G	14: 110,749,873	T801P	probably benign	Het
Spata31d1c	T	C	13: 65,037,080	V812A	possibly damaging	Het
Sphkap	A	C	1: 83,339,599	L59R	probably damaging	Het
Srsf10	C	A	4: 135,856,242	R6S	probably damaging	Het
Supt5	T	A	7: 28,329,475	R131S	probably benign	Het
Syne1	T	C	10: 5,360,706		probably null	Het
Tepp	A	T	8: 95,319,992	T98S	possibly damaging	Het
Tet2	T	A	3: 133,488,535	H46L	possibly damaging	Het
Tnfsf4	T	A	1: 161,417,248	N169K	probably damaging	Het
Tprg	A	T	16: 25,317,261	M1L	possibly damaging	Het
Tsen2	A	G	6: 115,559,595	Y104C	probably damaging	Het
Ttc6	A	G	12: 57,673,804	Y952C	probably damaging	Het
Umod	A	T	7: 119,471,427	I414N	probably damaging	Het
Usp10	G	T	8: 119,947,089	V398L	possibly damaging	Het
Vmn2r23	A	T	6: 123,741,895	I736F	possibly damaging	Het
Vmn2r65	C	A	7: 84,943,661	G446V	probably benign	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Yars2	A	G	16: 16,309,471	I467V	probably benign	Het
Ykt6	A	G	11: 5,959,338	E49G	possibly damaging	Het
Zan	T	A	5: 137,443,930	M1907L	unknown	Het
Zdhhc2	T	C	8: 40,464,236	S225P	probably damaging	Het
Zfc3h1	A	T	10: 115,431,357		probably benign	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGTGCAACTACAGCGGACAG -3'
(R):5'- CCATAAGGAGTCCTCAACAGTCG -3'

Sequencing Primer
(F):5'- AGCGGACAGGGCTGTGG -3'
(R):5'- GTCCTCAACAGTCGGGAAG -3'

Posted On

2017-02-28