Incidental Mutation 'R5935:Cabp2'
ID462227
Institutional Source Beutler Lab
Gene Symbol Cabp2
Ensembl Gene ENSMUSG00000024857
Gene Namecalcium binding protein 2
Synonyms
MMRRC Submission 044129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5935 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4081578-4087340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4086497 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 181 (A181D)
Ref Sequence ENSEMBL: ENSMUSP00000125255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159148] [ENSMUST00000159556] [ENSMUST00000159593] [ENSMUST00000162908]
Predicted Effect probably damaging
Transcript: ENSMUST00000159148
AA Change: A163D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125740
Gene: ENSMUSG00000024857
AA Change: A163D

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
EFh 65 93 2.62e-5 SMART
Blast:EFh 101 126 3e-6 BLAST
EFh 139 167 1.26e-7 SMART
EFh 176 203 3.85e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159556
AA Change: A128D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124389
Gene: ENSMUSG00000024857
AA Change: A128D

DomainStartEndE-ValueType
EFh 30 58 2.62e-5 SMART
Blast:EFh 66 91 2e-6 BLAST
EFh 104 132 1.26e-7 SMART
EFh 141 168 3.85e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159593
SMART Domains Protein: ENSMUSP00000124607
Gene: ENSMUSG00000024857

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
Pfam:EF-hand_1 65 93 2.8e-9 PFAM
Pfam:EF-hand_6 65 96 6.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162584
Predicted Effect probably damaging
Transcript: ENSMUST00000162908
AA Change: A181D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125255
Gene: ENSMUSG00000024857
AA Change: A181D

DomainStartEndE-ValueType
low complexity region 25 39 N/A INTRINSIC
EFh 83 111 2.62e-5 SMART
Blast:EFh 119 144 4e-6 BLAST
EFh 157 185 1.26e-7 SMART
EFh 194 221 3.85e-3 SMART
Meta Mutation Damage Score 0.8508 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (92/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a subfamily of calcium binding proteins that share similarity to calmodulin. Like calmodulin, these family members can likely stimulate calmodulin-dependent kinase II and the protein phosphatase calcineurin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous knockout affects calcium channels in cochlear inner hair cell synapses, resulting in hearing impairment. It also affects transmission of responses to light through the retinal circuits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,465 L230P probably benign Het
6430531B16Rik G A 7: 139,976,613 H154Y probably benign Het
Adam26b C G 8: 43,521,298 M222I probably benign Het
Ahnak T C 19: 9,015,182 V4610A possibly damaging Het
Ankrd13c C T 3: 157,947,583 silent Het
Cables2 A G 2: 180,262,048 probably benign Het
Camsap3 A G 8: 3,601,999 D265G probably damaging Het
Cbs G T 17: 31,632,879 T50N probably damaging Het
Ccdc129 A T 6: 55,897,769 R235* probably null Het
Cenpa A T 5: 30,673,037 Q83L possibly damaging Het
Cit A T 5: 115,925,539 probably benign Het
Ckap5 A G 2: 91,615,100 E1694G possibly damaging Het
Copz1 A T 15: 103,294,770 M104L probably benign Het
Crot T A 5: 8,974,192 M335L probably benign Het
Ctnna2 T C 6: 77,143,921 D373G probably benign Het
Ctu2 G A 8: 122,476,954 probably benign Het
Cyp3a59 T A 5: 146,090,645 Y75* probably null Het
Dbi A G 1: 120,120,853 I21T probably benign Het
Dcun1d3 A G 7: 119,859,576 S79P probably benign Het
Dock10 T A 1: 80,505,587 probably benign Het
Dstyk T A 1: 132,454,137 I543N probably damaging Het
Epx G T 11: 87,865,492 A621E probably damaging Het
Farp2 G A 1: 93,620,645 probably null Het
Gm11992 C T 11: 9,052,711 P25S probably damaging Het
Grik5 A T 7: 25,059,077 M307K possibly damaging Het
Hnf1b A T 11: 83,882,677 N234I probably damaging Het
Htr2a A G 14: 74,645,090 D172G probably damaging Het
Ifit1bl2 T C 19: 34,619,728 T163A probably benign Het
Igsf10 A T 3: 59,328,157 D1534E probably benign Het
Il3ra T G 14: 14,350,799 V178G probably damaging Het
Itgb1 A T 8: 128,713,237 K136* probably null Het
Lama2 T A 10: 27,015,498 I2540F probably benign Het
Lrp8 C A 4: 107,857,296 H622Q probably damaging Het
Lrrc2 T A 9: 110,966,561 M138K probably benign Het
Lrrk2 C A 15: 91,745,831 H1242N probably benign Het
Lsm11 G C 11: 45,944,618 R99G probably benign Het
Mif4gd C T 11: 115,609,613 V40M probably benign Het
Mpp3 A T 11: 102,025,415 V37D probably damaging Het
Mre11a T A 9: 14,786,962 D35E probably damaging Het
Mroh4 C A 15: 74,621,154 V233F probably damaging Het
Npy2r A T 3: 82,540,761 S123T possibly damaging Het
Nrip2 A G 6: 128,408,398 Y264C possibly damaging Het
Obscn A G 11: 59,006,813 S6639P unknown Het
Olfr574 T A 7: 102,948,810 F105Y probably benign Het
Olfr963 C T 9: 39,669,090 T11I probably benign Het
Osbpl5 C T 7: 143,756,958 probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pcdhb8 A G 18: 37,356,190 D307G probably damaging Het
Pde1b A G 15: 103,521,439 K120E possibly damaging Het
Pdzrn4 T C 15: 92,397,374 S154P probably benign Het
Ppp1r13b T C 12: 111,830,442 K889R probably benign Het
Ppp4r3a T A 12: 101,051,613 D439V probably damaging Het
Ptk2b A G 14: 66,173,879 I401T probably damaging Het
Rab24 T C 13: 55,320,530 T153A probably damaging Het
Rarb C A 14: 16,434,264 A305S probably damaging Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Scn10a G A 9: 119,627,171 T1194I probably damaging Het
Scn3a G T 2: 65,464,836 N1514K probably damaging Het
Serpinb3d T C 1: 107,083,375 T36A probably benign Het
Shisa5 T A 9: 109,056,683 M229K possibly damaging Het
Sik2 C T 9: 50,917,131 G204R probably damaging Het
Sla C T 15: 66,793,705 G46E probably damaging Het
Slc35g3 A T 11: 69,761,683 M1K probably null Het
Slc5a7 A T 17: 54,276,944 Y439* probably null Het
Slc9a1 T C 4: 133,419,865 probably benign Het
Slitrk6 T G 14: 110,749,873 T801P probably benign Het
Spata31d1c T C 13: 65,037,080 V812A possibly damaging Het
Sphkap A C 1: 83,339,599 L59R probably damaging Het
Srsf10 C A 4: 135,856,242 R6S probably damaging Het
Supt5 T A 7: 28,329,475 R131S probably benign Het
Syne1 T C 10: 5,360,706 probably null Het
Tepp A T 8: 95,319,992 T98S possibly damaging Het
Tet2 T A 3: 133,488,535 H46L possibly damaging Het
Tnfsf4 T A 1: 161,417,248 N169K probably damaging Het
Tprg A T 16: 25,317,261 M1L possibly damaging Het
Tsen2 A G 6: 115,559,595 Y104C probably damaging Het
Ttc6 A G 12: 57,673,804 Y952C probably damaging Het
Umod A T 7: 119,471,427 I414N probably damaging Het
Usp10 G T 8: 119,947,089 V398L possibly damaging Het
Vmn2r23 A T 6: 123,741,895 I736F possibly damaging Het
Vmn2r65 C A 7: 84,943,661 G446V probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Yars2 A G 16: 16,309,471 I467V probably benign Het
Ykt6 A G 11: 5,959,338 E49G possibly damaging Het
Zan T A 5: 137,443,930 M1907L unknown Het
Zdhhc2 T C 8: 40,464,236 S225P probably damaging Het
Zfc3h1 A T 10: 115,431,357 probably benign Het
Other mutations in Cabp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Cabp2 APN 19 4084868 splice site probably benign
IGL02338:Cabp2 APN 19 4084154 missense possibly damaging 0.74
R0017:Cabp2 UTSW 19 4086242 missense possibly damaging 0.88
R0153:Cabp2 UTSW 19 4084913 splice site probably benign
R0432:Cabp2 UTSW 19 4084903 missense possibly damaging 0.59
R2027:Cabp2 UTSW 19 4087126 missense probably damaging 1.00
R3693:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R3694:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R3695:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R5939:Cabp2 UTSW 19 4086470 missense possibly damaging 0.85
R6413:Cabp2 UTSW 19 4085698 splice site probably null
R7023:Cabp2 UTSW 19 4082658 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGACATGATTGGCGTGAGG -3'
(R):5'- TCGATCCTTCATGATAACTGAGAAC -3'

Sequencing Primer
(F):5'- AGCTTCGAGACGCCTTCC -3'
(R):5'- AATGCTGCGACCCTTTGATACAG -3'
Posted On2017-02-28