Mutagenetix > Incidental Mutations

Incidental Mutation 'R0567:Egfr'

46223

Institutional Source

Beutler Lab

Gene Symbol

Egfr

Ensembl Gene

ENSMUSG00000020122

Gene Name

epidermal growth factor receptor

Synonyms

avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1

MMRRC Submission

038758-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.909) question?

Stock #

R0567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16752203-16918158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 16872873 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 412 (D412V)

Ref Sequence

ENSEMBL: ENSMUSP00000099948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884]

Predicted Effect

probably benign
Transcript: ENSMUST00000020329
AA Change: D412V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: D412V

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	1.4e-32	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	1.8e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.05e1	SMART
low complexity region	677	694	N/A	INTRINSIC
TyrKc	714	970	2.88e-129	SMART
low complexity region	1004	1017	N/A	INTRINSIC
low complexity region	1027	1048	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102884
AA Change: D412V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122
AA Change: D412V

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	5e-33	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	2e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.54e0	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl1	A	G	4: 86,228,016	E303G	probably damaging	Het
Akr1b3	A	T	6: 34,304,345		probably null	Het
Alox8	A	T	11: 69,191,522		probably null	Het
Apcdd1	G	A	18: 62,934,036	E74K	possibly damaging	Het
Atr	T	C	9: 95,865,829	V388A	probably benign	Het
AW554918	G	A	18: 25,400,035	E452K	possibly damaging	Het
C1galt1	A	G	6: 7,866,874	D240G	probably damaging	Het
Ccdc130	A	G	8: 84,260,665	L93P	probably damaging	Het
Ceacam10	T	A	7: 24,778,409	D116E	probably damaging	Het
Col15a1	G	T	4: 47,293,231	V912L	possibly damaging	Het
Cyp3a11	G	A	5: 145,869,149	T136I	probably damaging	Het
Denr	C	T	5: 123,908,158	T17M	probably benign	Het
Doc2b	A	G	11: 75,780,124	F227S	probably damaging	Het
Dsp	A	T	13: 38,192,438	T1400S	probably benign	Het
Fryl	C	T	5: 73,065,391	G1949D	possibly damaging	Het
Gstp3	A	T	19: 4,057,636	L176Q	possibly damaging	Het
Heatr5a	T	A	12: 51,910,089	N1075I	probably damaging	Het
Hist1h2ah	T	C	13: 22,035,564		probably benign	Het
Ighv1-69	C	T	12: 115,623,549		probably benign	Het
Lama3	A	G	18: 12,549,252	I1092V	probably benign	Het
Lipg	A	T	18: 74,957,369	H36Q	probably benign	Het
Myh7b	T	C	2: 155,626,398	W836R	probably damaging	Het
Oit3	A	T	10: 59,435,978	C186S	probably damaging	Het
Olfr734	A	T	14: 50,320,658	M59K	probably damaging	Het
P2ry2	T	C	7: 100,998,541	T186A	probably damaging	Het
Pyroxd2	T	C	19: 42,735,925	T300A	probably benign	Het
Rab26	C	A	17: 24,529,582	V283F	probably damaging	Het
Rad50	C	T	11: 53,654,956	R1180Q	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Shroom3	A	G	5: 92,964,453	D1891G	possibly damaging	Het
Syne2	G	A	12: 75,890,230	E201K	probably damaging	Het
Taf6	A	T	5: 138,183,726		probably null	Het
Tbc1d32	A	T	10: 56,173,963	M493K	possibly damaging	Het
Uaca	A	G	9: 60,871,381	T1017A	probably benign	Het
Usp17le	C	T	7: 104,768,898	V346I	possibly damaging	Het
Vmn1r71	T	C	7: 10,748,629	D44G	probably damaging	Het
Vmn2r80	A	G	10: 79,194,831	I830M	possibly damaging	Het
Zfp994	T	C	17: 22,200,468	Y500C	possibly damaging	Het
Zscan20	A	G	4: 128,589,450		probably null	Het

Other mutations in Egfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Egfr	APN	11	16863020	missense	probably damaging	1.00
IGL01529:Egfr	APN	11	16863014	missense	probably benign
IGL01556:Egfr	APN	11	16905382	missense	probably damaging	1.00
IGL02627:Egfr	APN	11	16869346	missense	probably damaging	1.00
IGL02862:Egfr	APN	11	16883562	missense	probably benign	0.25
IGL02945:Egfr	APN	11	16752514	missense	probably damaging	1.00
IGL02994:Egfr	APN	11	16911811	missense	probably damaging	1.00
IGL03395:Egfr	APN	11	16910261	splice site	probably benign
set	UTSW	11	16871881	splice site	probably benign
Velvet	UTSW	11	16904399	missense	probably damaging	1.00
PIT1430001:Egfr	UTSW	11	16910214	missense	probably benign	0.00
R0196:Egfr	UTSW	11	16911746	missense	probably benign	0.02
R0513:Egfr	UTSW	11	16872855	missense	probably damaging	1.00
R0629:Egfr	UTSW	11	16869333	missense	probably damaging	1.00
R0961:Egfr	UTSW	11	16862964	missense	probably damaging	1.00
R1163:Egfr	UTSW	11	16883546	missense	probably benign	0.02
R1454:Egfr	UTSW	11	16889920	missense	probably benign
R1456:Egfr	UTSW	11	16863065	missense	probably benign	0.00
R1503:Egfr	UTSW	11	16869301	missense	possibly damaging	0.86
R1577:Egfr	UTSW	11	16869241	missense	probably benign	0.04
R1595:Egfr	UTSW	11	16906847	missense	probably damaging	0.99
R1699:Egfr	UTSW	11	16859019	missense	probably benign	0.14
R2172:Egfr	UTSW	11	16911562	missense	probably benign	0.00
R3690:Egfr	UTSW	11	16871881	splice site	probably benign
R3922:Egfr	UTSW	11	16881495	missense	probably damaging	1.00
R4444:Egfr	UTSW	11	16871027	missense	probably benign	0.00
R4685:Egfr	UTSW	11	16858980	missense	probably damaging	1.00
R4737:Egfr	UTSW	11	16869231	missense	probably damaging	0.99
R4814:Egfr	UTSW	11	16869354	missense	probably damaging	1.00
R4841:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4842:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4903:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4964:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4985:Egfr	UTSW	11	16859029	nonsense	probably null
R4998:Egfr	UTSW	11	16881493	missense	possibly damaging	0.58
R5001:Egfr	UTSW	11	16904434	missense	probably damaging	0.98
R5304:Egfr	UTSW	11	16884260	missense	probably benign
R5309:Egfr	UTSW	11	16911703	missense	probably benign	0.00
R5653:Egfr	UTSW	11	16911617	missense	probably benign	0.04
R5905:Egfr	UTSW	11	16911494	missense	probably damaging	1.00
R6051:Egfr	UTSW	11	16883607	missense	possibly damaging	0.87
R6052:Egfr	UTSW	11	16911554	missense	probably benign	0.16
R6114:Egfr	UTSW	11	16904374	missense	possibly damaging	0.46
R6261:Egfr	UTSW	11	16889964	missense	probably benign	0.11
R6434:Egfr	UTSW	11	16869294	missense	probably benign	0.25
R6475:Egfr	UTSW	11	16891259	missense	probably benign
R6799:Egfr	UTSW	11	16896952	missense	probably damaging	1.00
R7143:Egfr	UTSW	11	16871627	missense	probably benign	0.20
R7195:Egfr	UTSW	11	16868162	missense	probably damaging	1.00
R7459:Egfr	UTSW	11	16896967	missense	probably damaging	1.00
R7612:Egfr	UTSW	11	16859025	missense	possibly damaging	0.74
R7757:Egfr	UTSW	11	16889966	missense	possibly damaging	0.64
R7763:Egfr	UTSW	11	16891266	missense	probably damaging	1.00
R8315:Egfr	UTSW	11	16875027	missense	probably benign	0.08
R8320:Egfr	UTSW	11	16891251	missense	probably damaging	1.00
R8324:Egfr	UTSW	11	16858971	missense	probably damaging	0.99
R8324:Egfr	UTSW	11	16908885	missense	probably damaging	0.98
R8347:Egfr	UTSW	11	16878174	missense	probably damaging	1.00
R8440:Egfr	UTSW	11	16909831	missense	probably damaging	1.00
R8511:Egfr	UTSW	11	16896949	missense	probably damaging	1.00
Z1177:Egfr	UTSW	11	16862954	missense	probably benign	0.05
Z1177:Egfr	UTSW	11	16869319	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACCTGTGTGAGGACATGCACTATC -3'
(R):5'- TCTCTGTCTCCCTGGTGTGACAAG -3'

Sequencing Primer
(F):5'- GAGGACATGCACTATCATCCTTG -3'
(R):5'- tggagaggacagaaaagaatgg -3'

Posted On

2013-06-11