Incidental Mutation 'R5936:Firrm'
ID 462233
Institutional Source Beutler Lab
Gene Symbol Firrm
Ensembl Gene ENSMUSG00000041406
Gene Name FIGNL1 interacting regulator of recombination and mitosis
Synonyms BC055324
MMRRC Submission 044130-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5936 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 163773562-163822365 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 163814581 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 121 (I121L)
Ref Sequence ENSEMBL: ENSMUSP00000095101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045876] [ENSMUST00000097493] [ENSMUST00000160926]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045876
AA Change: I121L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406
AA Change: I121L

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097493
AA Change: I121L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406
AA Change: I121L

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160926
SMART Domains Protein: ENSMUSP00000124826
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162949
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 91% (77/85)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,445,848 (GRCm39) probably benign Het
Acnat2 T C 4: 49,383,362 (GRCm39) T64A probably benign Het
Afap1 A G 5: 36,131,740 (GRCm39) N356D possibly damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Alpk2 G A 18: 65,483,591 (GRCm39) T139M probably damaging Het
Ankrd46 T C 15: 36,479,428 (GRCm39) D221G probably benign Het
Ano6 T A 15: 95,870,482 (GRCm39) L900H probably damaging Het
Asphd2 G A 5: 112,533,623 (GRCm39) R343* probably null Het
Atosa T C 9: 74,916,586 (GRCm39) L395P probably benign Het
Brdt A G 5: 107,507,261 (GRCm39) T554A probably damaging Het
Cacna1d A G 14: 29,893,271 (GRCm39) V401A possibly damaging Het
Cbs T C 17: 31,844,068 (GRCm39) T188A probably damaging Het
Cfap54 T A 10: 92,798,274 (GRCm39) T1662S probably benign Het
Chka A G 19: 3,934,580 (GRCm39) I205V probably benign Het
Chsy1 T A 7: 65,822,025 (GRCm39) N753K possibly damaging Het
Cpz A G 5: 35,659,987 (GRCm39) S553P probably benign Het
Crtac1 A G 19: 42,312,276 (GRCm39) Y146H probably damaging Het
Csf1r A T 18: 61,258,880 (GRCm39) I700F probably damaging Het
Ddx20 C A 3: 105,587,903 (GRCm39) E392D possibly damaging Het
Dhrs11 G T 11: 84,716,350 (GRCm39) Y67* probably null Het
Diaph3 G T 14: 87,009,552 (GRCm39) Q1076K possibly damaging Het
Dop1a T A 9: 86,418,565 (GRCm39) L2037* probably null Het
Dst G T 1: 34,346,539 (GRCm39) V5336L probably damaging Het
Etv1 C A 12: 38,885,209 (GRCm39) H248Q probably damaging Het
Fcgbp T C 7: 27,786,117 (GRCm39) V518A probably damaging Het
Fchsd2 T C 7: 100,840,908 (GRCm39) L139S probably damaging Het
Fer A T 17: 64,231,058 (GRCm39) T270S probably benign Het
Fgd5 A G 6: 91,964,892 (GRCm39) E375G probably damaging Het
Gabarapl1 T A 6: 129,515,566 (GRCm39) I68N probably benign Het
Gopc C T 10: 52,222,295 (GRCm39) V30M probably damaging Het
Hbp1 T C 12: 31,987,095 (GRCm39) probably null Het
Helz2 A G 2: 180,872,560 (GRCm39) V2480A probably damaging Het
Igfbp3 T A 11: 7,159,472 (GRCm39) Y247F probably damaging Het
Kbtbd11 C A 8: 15,077,534 (GRCm39) S44R probably benign Het
Kcnk10 G T 12: 98,456,191 (GRCm39) S213R probably benign Het
Kcnq3 T A 15: 65,871,959 (GRCm39) D570V probably damaging Het
Kif21a A G 15: 90,819,850 (GRCm39) F1594S possibly damaging Het
Klf3 A G 5: 64,980,303 (GRCm39) D31G probably damaging Het
Mapkapk3 T C 9: 107,166,369 (GRCm39) K59E probably damaging Het
Myo18a A G 11: 77,709,039 (GRCm39) T484A probably damaging Het
Nlrp6 T A 7: 140,502,725 (GRCm39) L277* probably null Het
Nr5a1 G T 2: 38,591,790 (GRCm39) probably benign Het
Nsmaf C T 4: 6,421,017 (GRCm39) probably benign Het
Or4f58 T A 2: 111,851,932 (GRCm39) H89L probably benign Het
Orc1 A G 4: 108,459,180 (GRCm39) T450A probably benign Het
Pacsin1 A T 17: 27,923,971 (GRCm39) I122F probably benign Het
Pced1b T A 15: 97,283,061 (GRCm39) Y367N possibly damaging Het
Pced1b T A 15: 97,283,063 (GRCm39) Y367* probably null Het
Pdpk1 A G 17: 24,312,203 (GRCm39) F281L probably damaging Het
Piwil1 T C 5: 128,828,142 (GRCm39) V714A probably benign Het
Plcd3 C T 11: 102,969,173 (GRCm39) V265M probably damaging Het
Ppp1r1c A T 2: 79,586,798 (GRCm39) E48V possibly damaging Het
Prl2b1 T G 13: 27,572,432 (GRCm39) T53P probably damaging Het
Ptch2 T G 4: 116,965,491 (GRCm39) F359V probably benign Het
R3hdm2 G A 10: 127,307,681 (GRCm39) S314N probably damaging Het
Rictor A T 15: 6,813,642 (GRCm39) S1043C probably damaging Het
Rtn4rl2 A T 2: 84,710,775 (GRCm39) L163Q probably damaging Het
Sarnp T A 10: 128,684,640 (GRCm39) S129T probably benign Het
Scube3 A T 17: 28,384,461 (GRCm39) K585M probably damaging Het
Sgk3 C T 1: 9,956,045 (GRCm39) probably benign Het
Skint6 C T 4: 112,953,790 (GRCm39) S458N probably benign Het
Slc25a54 A G 3: 109,005,954 (GRCm39) H154R possibly damaging Het
Sorbs1 A C 19: 40,313,216 (GRCm39) I690S probably damaging Het
Sqle C A 15: 59,202,678 (GRCm39) A512D probably damaging Het
Tedc2 A C 17: 24,435,315 (GRCm39) L358R probably damaging Het
Tfr2 A G 5: 137,585,268 (GRCm39) S767G probably benign Het
Thoc5 A G 11: 4,854,133 (GRCm39) E27G probably damaging Het
Trappc8 A T 18: 21,007,745 (GRCm39) F123L probably damaging Het
Ube3d C T 9: 86,254,512 (GRCm39) G323D probably benign Het
Unc13c T A 9: 73,485,774 (GRCm39) H1642L probably damaging Het
Vmn1r10 A T 6: 57,091,302 (GRCm39) H298L probably benign Het
Xpo4 A T 14: 57,880,956 (GRCm39) Y26N probably benign Het
Zer1 A G 2: 29,997,679 (GRCm39) L409P probably damaging Het
Zfyve28 A T 5: 34,382,332 (GRCm39) L256Q probably damaging Het
Zgrf1 A G 3: 127,355,902 (GRCm39) E376G possibly damaging Het
Other mutations in Firrm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02051:Firrm APN 1 163,785,091 (GRCm39) missense probably benign 0.01
IGL02638:Firrm APN 1 163,786,868 (GRCm39) nonsense probably null
IGL03337:Firrm APN 1 163,818,328 (GRCm39) missense probably damaging 0.96
IGL03048:Firrm UTSW 1 163,792,094 (GRCm39) missense probably benign 0.04
R0106:Firrm UTSW 1 163,810,380 (GRCm39) unclassified probably benign
R0106:Firrm UTSW 1 163,810,380 (GRCm39) unclassified probably benign
R0414:Firrm UTSW 1 163,795,890 (GRCm39) missense probably benign 0.02
R0511:Firrm UTSW 1 163,799,412 (GRCm39) splice site probably null
R1323:Firrm UTSW 1 163,783,030 (GRCm39) unclassified probably benign
R1870:Firrm UTSW 1 163,792,363 (GRCm39) missense probably damaging 1.00
R2129:Firrm UTSW 1 163,794,026 (GRCm39) missense probably damaging 1.00
R3716:Firrm UTSW 1 163,784,457 (GRCm39) missense probably damaging 1.00
R3783:Firrm UTSW 1 163,815,252 (GRCm39) missense probably benign 0.27
R3872:Firrm UTSW 1 163,814,533 (GRCm39) missense probably damaging 0.99
R4427:Firrm UTSW 1 163,781,853 (GRCm39) missense probably benign
R5069:Firrm UTSW 1 163,815,243 (GRCm39) missense possibly damaging 0.59
R5620:Firrm UTSW 1 163,789,613 (GRCm39) nonsense probably null
R5681:Firrm UTSW 1 163,789,654 (GRCm39) missense probably damaging 1.00
R5699:Firrm UTSW 1 163,785,120 (GRCm39) missense probably benign 0.26
R6065:Firrm UTSW 1 163,815,257 (GRCm39) missense probably damaging 1.00
R6065:Firrm UTSW 1 163,786,957 (GRCm39) missense probably benign 0.08
R6075:Firrm UTSW 1 163,805,656 (GRCm39) missense probably damaging 1.00
R6466:Firrm UTSW 1 163,781,734 (GRCm39) missense probably benign 0.01
R6701:Firrm UTSW 1 163,799,412 (GRCm39) splice site probably null
R6776:Firrm UTSW 1 163,804,318 (GRCm39) missense probably damaging 1.00
R6851:Firrm UTSW 1 163,792,336 (GRCm39) missense probably damaging 1.00
R6923:Firrm UTSW 1 163,814,454 (GRCm39) critical splice donor site probably null
R7125:Firrm UTSW 1 163,789,631 (GRCm39) missense probably benign 0.00
R7361:Firrm UTSW 1 163,813,602 (GRCm39) missense possibly damaging 0.54
R7492:Firrm UTSW 1 163,786,897 (GRCm39) missense probably benign 0.35
R8528:Firrm UTSW 1 163,813,652 (GRCm39) missense probably damaging 1.00
R8755:Firrm UTSW 1 163,786,895 (GRCm39) missense probably damaging 1.00
R8786:Firrm UTSW 1 163,792,040 (GRCm39) missense probably damaging 1.00
R8938:Firrm UTSW 1 163,789,541 (GRCm39) missense probably benign 0.01
R8957:Firrm UTSW 1 163,792,335 (GRCm39) missense probably damaging 1.00
R9023:Firrm UTSW 1 163,818,300 (GRCm39) missense possibly damaging 0.83
R9132:Firrm UTSW 1 163,814,514 (GRCm39) missense probably damaging 0.99
R9159:Firrm UTSW 1 163,814,514 (GRCm39) missense probably damaging 0.99
R9229:Firrm UTSW 1 163,794,659 (GRCm39) missense probably damaging 1.00
R9310:Firrm UTSW 1 163,792,089 (GRCm39) missense probably damaging 1.00
R9455:Firrm UTSW 1 163,781,721 (GRCm39) missense probably benign 0.05
R9463:Firrm UTSW 1 163,795,907 (GRCm39) missense probably benign 0.00
R9597:Firrm UTSW 1 163,804,340 (GRCm39) missense probably null 1.00
R9646:Firrm UTSW 1 163,822,195 (GRCm39) missense probably damaging 0.97
Z1177:Firrm UTSW 1 163,792,086 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCATGCCTGAGGTACCAC -3'
(R):5'- CAAGATGGCACCCTGAACTG -3'

Sequencing Primer
(F):5'- TGAGGTACCACCCCTGCTAC -3'
(R):5'- CCCTGAACTGGGTCATGATTC -3'
Posted On 2017-02-28