Incidental Mutation 'R5936:Olfr1311'
ID462238
Institutional Source Beutler Lab
Gene Symbol Olfr1311
Ensembl Gene ENSMUSG00000109403
Gene Nameolfactory receptor 1311
SynonymsGA_x6K02T2Q125-73069292-73068354, MOR245-21
MMRRC Submission 044130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5936 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112019656-112024412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112021587 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 89 (H89L)
Ref Sequence ENSEMBL: ENSMUSP00000150617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208536] [ENSMUST00000213602] [ENSMUST00000215321]
Predicted Effect probably benign
Transcript: ENSMUST00000099601
AA Change: H89L

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097196
Gene: ENSMUSG00000074948
AA Change: H89L

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.9e-43 PFAM
Pfam:7tm_1 41 287 3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208536
AA Change: H89L

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000213602
AA Change: H89L

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215321
AA Change: H89L

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216319
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 91% (77/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,504 probably benign Het
Acnat2 T C 4: 49,383,362 T64A probably benign Het
Afap1 A G 5: 35,974,396 N356D possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Ankrd46 T C 15: 36,479,282 D221G probably benign Het
Ano6 T A 15: 95,972,601 L900H probably damaging Het
Asphd2 G A 5: 112,385,757 R343* probably null Het
BC055324 T G 1: 163,987,012 I121L probably benign Het
Brdt A G 5: 107,359,395 T554A probably damaging Het
Cacna1d A G 14: 30,171,314 V401A possibly damaging Het
Cbs T C 17: 31,625,094 T188A probably damaging Het
Cfap54 T A 10: 92,962,412 T1662S probably benign Het
Chka A G 19: 3,884,580 I205V probably benign Het
Chsy1 T A 7: 66,172,277 N753K possibly damaging Het
Cpz A G 5: 35,502,643 S553P probably benign Het
Crtac1 A G 19: 42,323,837 Y146H probably damaging Het
Csf1r A T 18: 61,125,808 I700F probably damaging Het
Ddx20 C A 3: 105,680,587 E392D possibly damaging Het
Dhrs11 G T 11: 84,825,524 Y67* probably null Het
Diaph3 G T 14: 86,772,116 Q1076K possibly damaging Het
Dopey1 T A 9: 86,536,512 L2037* probably null Het
Dst G T 1: 34,307,458 V5336L probably damaging Het
Etv1 C A 12: 38,835,210 H248Q probably damaging Het
Fam214a T C 9: 75,009,304 L395P probably benign Het
Fcgbp T C 7: 28,086,692 V518A probably damaging Het
Fchsd2 T C 7: 101,191,701 L139S probably damaging Het
Fer A T 17: 63,924,063 T270S probably benign Het
Fgd5 A G 6: 91,987,911 E375G probably damaging Het
Gabarapl1 T A 6: 129,538,603 I68N probably benign Het
Gopc C T 10: 52,346,199 V30M probably damaging Het
Hbp1 T C 12: 31,937,096 probably null Het
Helz2 A G 2: 181,230,767 V2480A probably damaging Het
Igfbp3 T A 11: 7,209,472 Y247F probably damaging Het
Kbtbd11 C A 8: 15,027,534 S44R probably benign Het
Kcnk10 G T 12: 98,489,932 S213R probably benign Het
Kcnq3 T A 15: 66,000,110 D570V probably damaging Het
Kif21a A G 15: 90,935,647 F1594S possibly damaging Het
Klf3 A G 5: 64,822,960 D31G probably damaging Het
Mapkapk3 T C 9: 107,289,170 K59E probably damaging Het
Myo18a A G 11: 77,818,213 T484A probably damaging Het
Nlrp6 T A 7: 140,922,812 L277* probably null Het
Nr5a1 G T 2: 38,701,778 probably benign Het
Nsmaf C T 4: 6,421,017 probably benign Het
Orc1 A G 4: 108,601,983 T450A probably benign Het
Pacsin1 A T 17: 27,704,997 I122F probably benign Het
Pced1b T A 15: 97,385,180 Y367N possibly damaging Het
Pced1b T A 15: 97,385,182 Y367* probably null Het
Pdpk1 A G 17: 24,093,229 F281L probably damaging Het
Piwil1 T C 5: 128,751,078 V714A probably benign Het
Plcd3 C T 11: 103,078,347 V265M probably damaging Het
Ppp1r1c A T 2: 79,756,454 E48V possibly damaging Het
Prl2b1 T G 13: 27,388,449 T53P probably damaging Het
Ptch2 T G 4: 117,108,294 F359V probably benign Het
R3hdm2 G A 10: 127,471,812 S314N probably damaging Het
Rictor A T 15: 6,784,161 S1043C probably damaging Het
Rtn4rl2 A T 2: 84,880,431 L163Q probably damaging Het
Sarnp T A 10: 128,848,771 S129T probably benign Het
Scube3 A T 17: 28,165,487 K585M probably damaging Het
Sgk3 C T 1: 9,885,820 probably benign Het
Skint6 C T 4: 113,096,593 S458N probably benign Het
Slc25a54 A G 3: 109,098,638 H154R possibly damaging Het
Sorbs1 A C 19: 40,324,772 I690S probably damaging Het
Sqle C A 15: 59,330,829 A512D probably damaging Het
Tedc2 A C 17: 24,216,341 L358R probably damaging Het
Tfr2 A G 5: 137,587,006 S767G probably benign Het
Thoc5 A G 11: 4,904,133 E27G probably damaging Het
Trappc8 A T 18: 20,874,688 F123L probably damaging Het
Ube2cbp C T 9: 86,372,459 G323D probably benign Het
Unc13c T A 9: 73,578,492 H1642L probably damaging Het
Vmn1r10 A T 6: 57,114,317 H298L probably benign Het
Xpo4 A T 14: 57,643,499 Y26N probably benign Het
Zer1 A G 2: 30,107,667 L409P probably damaging Het
Zfyve28 A T 5: 34,224,988 L256Q probably damaging Het
Zgrf1 A G 3: 127,562,253 E376G possibly damaging Het
Other mutations in Olfr1311
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1311 APN 2 112021132 missense probably damaging 1.00
IGL02626:Olfr1311 APN 2 112021113 missense probably damaging 1.00
R0499:Olfr1311 UTSW 2 112021432 missense probably damaging 1.00
R1511:Olfr1311 UTSW 2 112021404 missense probably benign 0.00
R3439:Olfr1311 UTSW 2 112021447 missense possibly damaging 0.95
R4564:Olfr1311 UTSW 2 112021767 missense possibly damaging 0.80
R4756:Olfr1311 UTSW 2 112020987 missense possibly damaging 0.52
R4776:Olfr1311 UTSW 2 112020931 missense probably benign 0.01
R5777:Olfr1311 UTSW 2 112021531 missense probably damaging 1.00
R6283:Olfr1311 UTSW 2 112021260 missense possibly damaging 0.91
R6368:Olfr1311 UTSW 2 112021551 missense probably damaging 0.99
R6484:Olfr1311 UTSW 2 112021419 nonsense probably null
R7373:Olfr1311 UTSW 2 112021442 missense probably benign
X0065:Olfr1311 UTSW 2 112021635 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGTCCAAGGACCCAGGATAC -3'
(R):5'- TGGGGAATCCAGTTGCTTC -3'

Sequencing Primer
(F):5'- TCAAAGGCCATGGCTATG -3'
(R):5'- GGGGAATCCAGTTGCTTCTCTTC -3'
Posted On2017-02-28