Incidental Mutation 'R5936:Acnat2'
ID462244
Institutional Source Beutler Lab
Gene Symbol Acnat2
Ensembl Gene ENSMUSG00000060317
Gene Nameacyl-coenzyme A amino acid N-acyltransferase 2
SynonymsC730036D15Rik
MMRRC Submission 044130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5936 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location49379840-49408151 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49383362 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 64 (T64A)
Ref Sequence ENSEMBL: ENSMUSP00000103326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081541] [ENSMUST00000107698] [ENSMUST00000125123]
Predicted Effect probably benign
Transcript: ENSMUST00000081541
AA Change: T64A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080256
Gene: ENSMUSG00000060317
AA Change: T64A

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 15 144 6e-44 PFAM
low complexity region 149 173 N/A INTRINSIC
Pfam:BAAT_C 206 415 2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107698
AA Change: T64A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103326
Gene: ENSMUSG00000060317
AA Change: T64A

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 145 9.8e-42 PFAM
Pfam:BAAT_C 188 397 6.6e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125123
AA Change: T64A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119135
Gene: ENSMUSG00000060317
AA Change: T64A

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 145 2.4e-42 PFAM
low complexity region 149 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139564
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 91% (77/85)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,504 probably benign Het
Afap1 A G 5: 35,974,396 N356D possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Ankrd46 T C 15: 36,479,282 D221G probably benign Het
Ano6 T A 15: 95,972,601 L900H probably damaging Het
Asphd2 G A 5: 112,385,757 R343* probably null Het
BC055324 T G 1: 163,987,012 I121L probably benign Het
Brdt A G 5: 107,359,395 T554A probably damaging Het
Cacna1d A G 14: 30,171,314 V401A possibly damaging Het
Cbs T C 17: 31,625,094 T188A probably damaging Het
Cfap54 T A 10: 92,962,412 T1662S probably benign Het
Chka A G 19: 3,884,580 I205V probably benign Het
Chsy1 T A 7: 66,172,277 N753K possibly damaging Het
Cpz A G 5: 35,502,643 S553P probably benign Het
Crtac1 A G 19: 42,323,837 Y146H probably damaging Het
Csf1r A T 18: 61,125,808 I700F probably damaging Het
Ddx20 C A 3: 105,680,587 E392D possibly damaging Het
Dhrs11 G T 11: 84,825,524 Y67* probably null Het
Diaph3 G T 14: 86,772,116 Q1076K possibly damaging Het
Dopey1 T A 9: 86,536,512 L2037* probably null Het
Dst G T 1: 34,307,458 V5336L probably damaging Het
Etv1 C A 12: 38,835,210 H248Q probably damaging Het
Fam214a T C 9: 75,009,304 L395P probably benign Het
Fcgbp T C 7: 28,086,692 V518A probably damaging Het
Fchsd2 T C 7: 101,191,701 L139S probably damaging Het
Fer A T 17: 63,924,063 T270S probably benign Het
Fgd5 A G 6: 91,987,911 E375G probably damaging Het
Gabarapl1 T A 6: 129,538,603 I68N probably benign Het
Gopc C T 10: 52,346,199 V30M probably damaging Het
Hbp1 T C 12: 31,937,096 probably null Het
Helz2 A G 2: 181,230,767 V2480A probably damaging Het
Igfbp3 T A 11: 7,209,472 Y247F probably damaging Het
Kbtbd11 C A 8: 15,027,534 S44R probably benign Het
Kcnk10 G T 12: 98,489,932 S213R probably benign Het
Kcnq3 T A 15: 66,000,110 D570V probably damaging Het
Kif21a A G 15: 90,935,647 F1594S possibly damaging Het
Klf3 A G 5: 64,822,960 D31G probably damaging Het
Mapkapk3 T C 9: 107,289,170 K59E probably damaging Het
Myo18a A G 11: 77,818,213 T484A probably damaging Het
Nlrp6 T A 7: 140,922,812 L277* probably null Het
Nr5a1 G T 2: 38,701,778 probably benign Het
Nsmaf C T 4: 6,421,017 probably benign Het
Olfr1311 T A 2: 112,021,587 H89L probably benign Het
Orc1 A G 4: 108,601,983 T450A probably benign Het
Pacsin1 A T 17: 27,704,997 I122F probably benign Het
Pced1b T A 15: 97,385,180 Y367N possibly damaging Het
Pced1b T A 15: 97,385,182 Y367* probably null Het
Pdpk1 A G 17: 24,093,229 F281L probably damaging Het
Piwil1 T C 5: 128,751,078 V714A probably benign Het
Plcd3 C T 11: 103,078,347 V265M probably damaging Het
Ppp1r1c A T 2: 79,756,454 E48V possibly damaging Het
Prl2b1 T G 13: 27,388,449 T53P probably damaging Het
Ptch2 T G 4: 117,108,294 F359V probably benign Het
R3hdm2 G A 10: 127,471,812 S314N probably damaging Het
Rictor A T 15: 6,784,161 S1043C probably damaging Het
Rtn4rl2 A T 2: 84,880,431 L163Q probably damaging Het
Sarnp T A 10: 128,848,771 S129T probably benign Het
Scube3 A T 17: 28,165,487 K585M probably damaging Het
Sgk3 C T 1: 9,885,820 probably benign Het
Skint6 C T 4: 113,096,593 S458N probably benign Het
Slc25a54 A G 3: 109,098,638 H154R possibly damaging Het
Sorbs1 A C 19: 40,324,772 I690S probably damaging Het
Sqle C A 15: 59,330,829 A512D probably damaging Het
Tedc2 A C 17: 24,216,341 L358R probably damaging Het
Tfr2 A G 5: 137,587,006 S767G probably benign Het
Thoc5 A G 11: 4,904,133 E27G probably damaging Het
Trappc8 A T 18: 20,874,688 F123L probably damaging Het
Ube2cbp C T 9: 86,372,459 G323D probably benign Het
Unc13c T A 9: 73,578,492 H1642L probably damaging Het
Vmn1r10 A T 6: 57,114,317 H298L probably benign Het
Xpo4 A T 14: 57,643,499 Y26N probably benign Het
Zer1 A G 2: 30,107,667 L409P probably damaging Het
Zfyve28 A T 5: 34,224,988 L256Q probably damaging Het
Zgrf1 A G 3: 127,562,253 E376G possibly damaging Het
Other mutations in Acnat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Acnat2 APN 4 49383250 missense probably damaging 1.00
IGL01321:Acnat2 APN 4 49380269 missense probably damaging 0.99
IGL01891:Acnat2 APN 4 49383395 missense probably benign 0.00
IGL01993:Acnat2 APN 4 49380131 missense probably benign 0.00
IGL02517:Acnat2 APN 4 49380639 nonsense probably null
IGL02517:Acnat2 APN 4 49380647 missense possibly damaging 0.79
IGL03249:Acnat2 APN 4 49381787 missense probably benign 0.00
PIT4494001:Acnat2 UTSW 4 49383133 missense probably benign 0.16
R0050:Acnat2 UTSW 4 49380586 missense probably benign 0.03
R0462:Acnat2 UTSW 4 49383084 critical splice donor site probably null
R0482:Acnat2 UTSW 4 49383534 missense probably benign 0.09
R0590:Acnat2 UTSW 4 49383273 missense probably benign 0.00
R0616:Acnat2 UTSW 4 49380269 missense probably damaging 0.99
R1099:Acnat2 UTSW 4 49380484 missense probably benign 0.01
R1678:Acnat2 UTSW 4 49380568 missense probably damaging 0.98
R1710:Acnat2 UTSW 4 49380587 missense probably benign 0.16
R2190:Acnat2 UTSW 4 49383551 start codon destroyed probably benign
R4863:Acnat2 UTSW 4 49380172 missense probably damaging 1.00
R5031:Acnat2 UTSW 4 49380631 missense probably damaging 1.00
R5194:Acnat2 UTSW 4 49380452 missense probably benign
R6451:Acnat2 UTSW 4 49380262 missense probably benign 0.00
R6526:Acnat2 UTSW 4 49383497 missense probably benign 0.00
R6759:Acnat2 UTSW 4 49380254 missense probably benign 0.01
R7180:Acnat2 UTSW 4 49381803 nonsense probably null
R7356:Acnat2 UTSW 4 49383507 missense probably damaging 1.00
R7879:Acnat2 UTSW 4 49383299 missense probably damaging 1.00
R7962:Acnat2 UTSW 4 49383299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAATCCTGACTGTTTCTAGCC -3'
(R):5'- CTTTCATCACAGGGAGGAAGC -3'

Sequencing Primer
(F):5'- CTGTTTCTAGCCAGTTAACAGAGTCG -3'
(R):5'- CCTTGATGATGATCCAGTTGATAGCC -3'
Posted On2017-02-28