Mutagenetix > Incidental Mutation

Incidental Mutation 'R5936:Orc1'

462245

Institutional Source

Beutler Lab

Gene Symbol

Orc1

Ensembl Gene

ENSMUSG00000028587

Gene Name

origin recognition complex, subunit 1

Synonyms

MmORC1, Orc1l

MMRRC Submission

044130-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5936 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108579423-108614833 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108601983 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 450 (T450A)

Ref Sequence

ENSEMBL: ENSMUSP00000099805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102744]

AlphaFold

Q9Z1N2

PDB Structure

Structure of free mouse ORC1 BAH domain [X-RAY DIFFRACTION]
Structure of mouse ORC1 BAH domain bound to H4K20me2 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000102744
AA Change: T450A

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000099805
Gene: ENSMUSG00000028587
AA Change: T450A

Domain	Start	End	E-Value	Type
BAH	44	170	1.88e-31	SMART
low complexity region	394	417	N/A	INTRINSIC
AAA	505	656	1e-7	SMART
Cdc6_C	757	837	5.45e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126668

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129931

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.0%

Validation Efficiency

91% (77/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is the largest subunit of the ORC complex. While other ORC subunits are stable throughout the cell cycle, the levels of this protein vary during the cell cycle, which has been shown to be controlled by ubiquitin-mediated proteolysis after initiation of DNA replication. This protein is found to be selectively phosphorylated during mitosis. It is also reported to interact with MYST histone acetyltransferase 2 (MyST2/HBO1), a protein involved in control of transcription silencing. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	T	2: 68,615,504		probably benign	Het
Acnat2	T	C	4: 49,383,362	T64A	probably benign	Het
Afap1	A	G	5: 35,974,396	N356D	possibly damaging	Het
Ahi1	A	G	10: 20,965,933	D301G	probably damaging	Het
Alpk2	G	A	18: 65,350,520	T139M	probably damaging	Het
Ankrd46	T	C	15: 36,479,282	D221G	probably benign	Het
Ano6	T	A	15: 95,972,601	L900H	probably damaging	Het
Asphd2	G	A	5: 112,385,757	R343*	probably null	Het
BC055324	T	G	1: 163,987,012	I121L	probably benign	Het
Brdt	A	G	5: 107,359,395	T554A	probably damaging	Het
Cacna1d	A	G	14: 30,171,314	V401A	possibly damaging	Het
Cbs	T	C	17: 31,625,094	T188A	probably damaging	Het
Cfap54	T	A	10: 92,962,412	T1662S	probably benign	Het
Chka	A	G	19: 3,884,580	I205V	probably benign	Het
Chsy1	T	A	7: 66,172,277	N753K	possibly damaging	Het
Cpz	A	G	5: 35,502,643	S553P	probably benign	Het
Crtac1	A	G	19: 42,323,837	Y146H	probably damaging	Het
Csf1r	A	T	18: 61,125,808	I700F	probably damaging	Het
Ddx20	C	A	3: 105,680,587	E392D	possibly damaging	Het
Dhrs11	G	T	11: 84,825,524	Y67*	probably null	Het
Diaph3	G	T	14: 86,772,116	Q1076K	possibly damaging	Het
Dopey1	T	A	9: 86,536,512	L2037*	probably null	Het
Dst	G	T	1: 34,307,458	V5336L	probably damaging	Het
Etv1	C	A	12: 38,835,210	H248Q	probably damaging	Het
Fam214a	T	C	9: 75,009,304	L395P	probably benign	Het
Fcgbp	T	C	7: 28,086,692	V518A	probably damaging	Het
Fchsd2	T	C	7: 101,191,701	L139S	probably damaging	Het
Fer	A	T	17: 63,924,063	T270S	probably benign	Het
Fgd5	A	G	6: 91,987,911	E375G	probably damaging	Het
Gabarapl1	T	A	6: 129,538,603	I68N	probably benign	Het
Gopc	C	T	10: 52,346,199	V30M	probably damaging	Het
Hbp1	T	C	12: 31,937,096		probably null	Het
Helz2	A	G	2: 181,230,767	V2480A	probably damaging	Het
Igfbp3	T	A	11: 7,209,472	Y247F	probably damaging	Het
Kbtbd11	C	A	8: 15,027,534	S44R	probably benign	Het
Kcnk10	G	T	12: 98,489,932	S213R	probably benign	Het
Kcnq3	T	A	15: 66,000,110	D570V	probably damaging	Het
Kif21a	A	G	15: 90,935,647	F1594S	possibly damaging	Het
Klf3	A	G	5: 64,822,960	D31G	probably damaging	Het
Mapkapk3	T	C	9: 107,289,170	K59E	probably damaging	Het
Myo18a	A	G	11: 77,818,213	T484A	probably damaging	Het
Nlrp6	T	A	7: 140,922,812	L277*	probably null	Het
Nr5a1	G	T	2: 38,701,778		probably benign	Het
Nsmaf	C	T	4: 6,421,017		probably benign	Het
Olfr1311	T	A	2: 112,021,587	H89L	probably benign	Het
Pacsin1	A	T	17: 27,704,997	I122F	probably benign	Het
Pced1b	T	A	15: 97,385,182	Y367*	probably null	Het
Pced1b	T	A	15: 97,385,180	Y367N	possibly damaging	Het
Pdpk1	A	G	17: 24,093,229	F281L	probably damaging	Het
Piwil1	T	C	5: 128,751,078	V714A	probably benign	Het
Plcd3	C	T	11: 103,078,347	V265M	probably damaging	Het
Ppp1r1c	A	T	2: 79,756,454	E48V	possibly damaging	Het
Prl2b1	T	G	13: 27,388,449	T53P	probably damaging	Het
Ptch2	T	G	4: 117,108,294	F359V	probably benign	Het
R3hdm2	G	A	10: 127,471,812	S314N	probably damaging	Het
Rictor	A	T	15: 6,784,161	S1043C	probably damaging	Het
Rtn4rl2	A	T	2: 84,880,431	L163Q	probably damaging	Het
Sarnp	T	A	10: 128,848,771	S129T	probably benign	Het
Scube3	A	T	17: 28,165,487	K585M	probably damaging	Het
Sgk3	C	T	1: 9,885,820		probably benign	Het
Skint6	C	T	4: 113,096,593	S458N	probably benign	Het
Slc25a54	A	G	3: 109,098,638	H154R	possibly damaging	Het
Sorbs1	A	C	19: 40,324,772	I690S	probably damaging	Het
Sqle	C	A	15: 59,330,829	A512D	probably damaging	Het
Tedc2	A	C	17: 24,216,341	L358R	probably damaging	Het
Tfr2	A	G	5: 137,587,006	S767G	probably benign	Het
Thoc5	A	G	11: 4,904,133	E27G	probably damaging	Het
Trappc8	A	T	18: 20,874,688	F123L	probably damaging	Het
Ube2cbp	C	T	9: 86,372,459	G323D	probably benign	Het
Unc13c	T	A	9: 73,578,492	H1642L	probably damaging	Het
Vmn1r10	A	T	6: 57,114,317	H298L	probably benign	Het
Xpo4	A	T	14: 57,643,499	Y26N	probably benign	Het
Zer1	A	G	2: 30,107,667	L409P	probably damaging	Het
Zfyve28	A	T	5: 34,224,988	L256Q	probably damaging	Het
Zgrf1	A	G	3: 127,562,253	E376G	possibly damaging	Het

Other mutations in Orc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Orc1	APN	4	108595325	splice site	probably benign
IGL00709:Orc1	APN	4	108590778	critical splice donor site	probably null
IGL01124:Orc1	APN	4	108588787	splice site	probably benign
IGL01514:Orc1	APN	4	108602052	missense	probably damaging	0.97
IGL01677:Orc1	APN	4	108604585	missense	probably damaging	1.00
IGL01782:Orc1	APN	4	108606268	missense	possibly damaging	0.78
IGL01886:Orc1	APN	4	108603957	splice site	probably null
IGL01912:Orc1	APN	4	108590744	missense	probably damaging	1.00
IGL02057:Orc1	APN	4	108588729	missense	possibly damaging	0.53
IGL02155:Orc1	APN	4	108590677	missense	probably benign	0.00
IGL02311:Orc1	APN	4	108599974	missense	probably benign
IGL02616:Orc1	APN	4	108595479	missense	probably benign	0.00
R0012:Orc1	UTSW	4	108595646	critical splice donor site	probably null
R0195:Orc1	UTSW	4	108614308	nonsense	probably null
R0239:Orc1	UTSW	4	108595646	critical splice donor site	probably null
R0239:Orc1	UTSW	4	108595646	critical splice donor site	probably null
R0611:Orc1	UTSW	4	108602032	missense	probably benign
R1351:Orc1	UTSW	4	108595367	missense	probably benign	0.01
R1966:Orc1	UTSW	4	108612217	missense	probably damaging	1.00
R2018:Orc1	UTSW	4	108590700	missense	possibly damaging	0.95
R2398:Orc1	UTSW	4	108601969	missense	possibly damaging	0.68
R3110:Orc1	UTSW	4	108604560	missense	probably benign	0.01
R3112:Orc1	UTSW	4	108604560	missense	probably benign	0.01
R3712:Orc1	UTSW	4	108604021	missense	probably damaging	1.00
R3716:Orc1	UTSW	4	108614459	missense	probably damaging	1.00
R3829:Orc1	UTSW	4	108605631	missense	probably damaging	1.00
R4282:Orc1	UTSW	4	108606274	missense	probably benign	0.18
R4320:Orc1	UTSW	4	108588776	missense	probably benign
R4321:Orc1	UTSW	4	108588776	missense	probably benign
R4322:Orc1	UTSW	4	108588776	missense	probably benign
R4348:Orc1	UTSW	4	108593452	missense	probably damaging	0.98
R4562:Orc1	UTSW	4	108602055	critical splice donor site	probably null
R4772:Orc1	UTSW	4	108579568	utr 5 prime	probably benign
R4914:Orc1	UTSW	4	108604558	missense	probably damaging	1.00
R4964:Orc1	UTSW	4	108614473	makesense	probably null
R5219:Orc1	UTSW	4	108590769	missense	probably damaging	1.00
R5428:Orc1	UTSW	4	108599940	missense	probably benign	0.00
R5655:Orc1	UTSW	4	108593439	missense	probably benign	0.09
R5693:Orc1	UTSW	4	108613079	missense	probably benign	0.01
R5960:Orc1	UTSW	4	108606298	missense	possibly damaging	0.67
R6294:Orc1	UTSW	4	108590670	missense	probably benign	0.01
R6504:Orc1	UTSW	4	108590717	missense	probably benign	0.15
R6533:Orc1	UTSW	4	108597447	missense	probably benign	0.05
R6775:Orc1	UTSW	4	108603455	missense	probably damaging	1.00
R7123:Orc1	UTSW	4	108588687	start codon destroyed	probably damaging	0.99
R7156:Orc1	UTSW	4	108595459	missense	probably benign	0.00
R7327:Orc1	UTSW	4	108588714	missense	probably benign	0.01
R7552:Orc1	UTSW	4	108588754	missense	probably benign	0.41
R7842:Orc1	UTSW	4	108605547	missense	probably benign	0.00
R7899:Orc1	UTSW	4	108603371	splice site	probably null
R8033:Orc1	UTSW	4	108605564	missense	probably damaging	1.00
R9442:Orc1	UTSW	4	108612160	missense	probably benign	0.06
R9762:Orc1	UTSW	4	108590677	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACATGTTTGATGTGAGCGG -3'
(R):5'- CTCTTTCCTCATGAGAAAGCTTTCAG -3'

Sequencing Primer
(F):5'- TGATGTGAGCGGGTAGGGATAG -3'
(R):5'- GACTTTAATCTGACAAGCTGACTCC -3'

Posted On

2017-02-28