Incidental Mutation 'R5936:Nlrp6'
ID 462262
Institutional Source Beutler Lab
Gene Symbol Nlrp6
Ensembl Gene ENSMUSG00000038745
Gene Name NLR family, pyrin domain containing 6
Synonyms Nalp6
MMRRC Submission 044130-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R5936 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140500815-140509105 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 140502725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 277 (L277*)
Ref Sequence ENSEMBL: ENSMUSP00000139170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]
AlphaFold Q91WS2
Predicted Effect probably null
Transcript: ENSMUST00000106045
AA Change: L247*
SMART Domains Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: L247*

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 8.6e-44 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 675 697 N/A INTRINSIC
internal_repeat_1 715 763 9.43e-6 PROSPERO
internal_repeat_1 828 876 9.43e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183761
Predicted Effect probably null
Transcript: ENSMUST00000183845
AA Change: L247*
SMART Domains Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: L247*

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 5.5e-43 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
internal_repeat_1 702 750 1.26e-5 PROSPERO
internal_repeat_1 815 863 1.26e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000184560
AA Change: L277*
SMART Domains Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: L277*

DomainStartEndE-ValueType
PYRIN 45 126 5.44e-27 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:NACHT 224 393 8.2e-43 PFAM
coiled coil region 620 647 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
internal_repeat_1 732 780 1.55e-5 PROSPERO
internal_repeat_1 845 893 1.55e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 91% (77/85)
MGI Phenotype FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,445,848 (GRCm39) probably benign Het
Acnat2 T C 4: 49,383,362 (GRCm39) T64A probably benign Het
Afap1 A G 5: 36,131,740 (GRCm39) N356D possibly damaging Het
Ahi1 A G 10: 20,841,832 (GRCm39) D301G probably damaging Het
Alpk2 G A 18: 65,483,591 (GRCm39) T139M probably damaging Het
Ankrd46 T C 15: 36,479,428 (GRCm39) D221G probably benign Het
Ano6 T A 15: 95,870,482 (GRCm39) L900H probably damaging Het
Asphd2 G A 5: 112,533,623 (GRCm39) R343* probably null Het
Atosa T C 9: 74,916,586 (GRCm39) L395P probably benign Het
Brdt A G 5: 107,507,261 (GRCm39) T554A probably damaging Het
Cacna1d A G 14: 29,893,271 (GRCm39) V401A possibly damaging Het
Cbs T C 17: 31,844,068 (GRCm39) T188A probably damaging Het
Cfap54 T A 10: 92,798,274 (GRCm39) T1662S probably benign Het
Chka A G 19: 3,934,580 (GRCm39) I205V probably benign Het
Chsy1 T A 7: 65,822,025 (GRCm39) N753K possibly damaging Het
Cpz A G 5: 35,659,987 (GRCm39) S553P probably benign Het
Crtac1 A G 19: 42,312,276 (GRCm39) Y146H probably damaging Het
Csf1r A T 18: 61,258,880 (GRCm39) I700F probably damaging Het
Ddx20 C A 3: 105,587,903 (GRCm39) E392D possibly damaging Het
Dhrs11 G T 11: 84,716,350 (GRCm39) Y67* probably null Het
Diaph3 G T 14: 87,009,552 (GRCm39) Q1076K possibly damaging Het
Dop1a T A 9: 86,418,565 (GRCm39) L2037* probably null Het
Dst G T 1: 34,346,539 (GRCm39) V5336L probably damaging Het
Etv1 C A 12: 38,885,209 (GRCm39) H248Q probably damaging Het
Fcgbp T C 7: 27,786,117 (GRCm39) V518A probably damaging Het
Fchsd2 T C 7: 100,840,908 (GRCm39) L139S probably damaging Het
Fer A T 17: 64,231,058 (GRCm39) T270S probably benign Het
Fgd5 A G 6: 91,964,892 (GRCm39) E375G probably damaging Het
Firrm T G 1: 163,814,581 (GRCm39) I121L probably benign Het
Gabarapl1 T A 6: 129,515,566 (GRCm39) I68N probably benign Het
Gopc C T 10: 52,222,295 (GRCm39) V30M probably damaging Het
Hbp1 T C 12: 31,987,095 (GRCm39) probably null Het
Helz2 A G 2: 180,872,560 (GRCm39) V2480A probably damaging Het
Igfbp3 T A 11: 7,159,472 (GRCm39) Y247F probably damaging Het
Kbtbd11 C A 8: 15,077,534 (GRCm39) S44R probably benign Het
Kcnk10 G T 12: 98,456,191 (GRCm39) S213R probably benign Het
Kcnq3 T A 15: 65,871,959 (GRCm39) D570V probably damaging Het
Kif21a A G 15: 90,819,850 (GRCm39) F1594S possibly damaging Het
Klf3 A G 5: 64,980,303 (GRCm39) D31G probably damaging Het
Mapkapk3 T C 9: 107,166,369 (GRCm39) K59E probably damaging Het
Myo18a A G 11: 77,709,039 (GRCm39) T484A probably damaging Het
Nr5a1 G T 2: 38,591,790 (GRCm39) probably benign Het
Nsmaf C T 4: 6,421,017 (GRCm39) probably benign Het
Or4f58 T A 2: 111,851,932 (GRCm39) H89L probably benign Het
Orc1 A G 4: 108,459,180 (GRCm39) T450A probably benign Het
Pacsin1 A T 17: 27,923,971 (GRCm39) I122F probably benign Het
Pced1b T A 15: 97,283,061 (GRCm39) Y367N possibly damaging Het
Pced1b T A 15: 97,283,063 (GRCm39) Y367* probably null Het
Pdpk1 A G 17: 24,312,203 (GRCm39) F281L probably damaging Het
Piwil1 T C 5: 128,828,142 (GRCm39) V714A probably benign Het
Plcd3 C T 11: 102,969,173 (GRCm39) V265M probably damaging Het
Ppp1r1c A T 2: 79,586,798 (GRCm39) E48V possibly damaging Het
Prl2b1 T G 13: 27,572,432 (GRCm39) T53P probably damaging Het
Ptch2 T G 4: 116,965,491 (GRCm39) F359V probably benign Het
R3hdm2 G A 10: 127,307,681 (GRCm39) S314N probably damaging Het
Rictor A T 15: 6,813,642 (GRCm39) S1043C probably damaging Het
Rtn4rl2 A T 2: 84,710,775 (GRCm39) L163Q probably damaging Het
Sarnp T A 10: 128,684,640 (GRCm39) S129T probably benign Het
Scube3 A T 17: 28,384,461 (GRCm39) K585M probably damaging Het
Sgk3 C T 1: 9,956,045 (GRCm39) probably benign Het
Skint6 C T 4: 112,953,790 (GRCm39) S458N probably benign Het
Slc25a54 A G 3: 109,005,954 (GRCm39) H154R possibly damaging Het
Sorbs1 A C 19: 40,313,216 (GRCm39) I690S probably damaging Het
Sqle C A 15: 59,202,678 (GRCm39) A512D probably damaging Het
Tedc2 A C 17: 24,435,315 (GRCm39) L358R probably damaging Het
Tfr2 A G 5: 137,585,268 (GRCm39) S767G probably benign Het
Thoc5 A G 11: 4,854,133 (GRCm39) E27G probably damaging Het
Trappc8 A T 18: 21,007,745 (GRCm39) F123L probably damaging Het
Ube3d C T 9: 86,254,512 (GRCm39) G323D probably benign Het
Unc13c T A 9: 73,485,774 (GRCm39) H1642L probably damaging Het
Vmn1r10 A T 6: 57,091,302 (GRCm39) H298L probably benign Het
Xpo4 A T 14: 57,880,956 (GRCm39) Y26N probably benign Het
Zer1 A G 2: 29,997,679 (GRCm39) L409P probably damaging Het
Zfyve28 A T 5: 34,382,332 (GRCm39) L256Q probably damaging Het
Zgrf1 A G 3: 127,355,902 (GRCm39) E376G possibly damaging Het
Other mutations in Nlrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Nlrp6 APN 7 140,503,037 (GRCm39) missense probably damaging 1.00
IGL01066:Nlrp6 APN 7 140,501,709 (GRCm39) missense possibly damaging 0.88
IGL01966:Nlrp6 APN 7 140,505,103 (GRCm39) missense probably damaging 1.00
IGL02625:Nlrp6 APN 7 140,503,413 (GRCm39) missense probably benign 0.00
IGL02792:Nlrp6 APN 7 140,502,348 (GRCm39) missense probably damaging 0.97
IGL02813:Nlrp6 APN 7 140,503,333 (GRCm39) missense possibly damaging 0.86
IGL03140:Nlrp6 APN 7 140,507,400 (GRCm39) missense probably benign 0.01
R0608:Nlrp6 UTSW 7 140,503,399 (GRCm39) nonsense probably null
R1404:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R1404:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R1472:Nlrp6 UTSW 7 140,503,408 (GRCm39) missense probably damaging 1.00
R1587:Nlrp6 UTSW 7 140,502,959 (GRCm39) missense probably damaging 1.00
R1843:Nlrp6 UTSW 7 140,503,006 (GRCm39) missense probably damaging 1.00
R1959:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R2097:Nlrp6 UTSW 7 140,503,117 (GRCm39) missense probably damaging 1.00
R2118:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2119:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2120:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2121:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2290:Nlrp6 UTSW 7 140,502,076 (GRCm39) missense probably damaging 1.00
R3546:Nlrp6 UTSW 7 140,506,682 (GRCm39) missense probably benign 0.00
R3547:Nlrp6 UTSW 7 140,506,682 (GRCm39) missense probably benign 0.00
R3970:Nlrp6 UTSW 7 140,501,568 (GRCm39) missense probably damaging 1.00
R4483:Nlrp6 UTSW 7 140,501,694 (GRCm39) missense probably damaging 1.00
R4484:Nlrp6 UTSW 7 140,501,694 (GRCm39) missense probably damaging 1.00
R4869:Nlrp6 UTSW 7 140,504,006 (GRCm39) missense probably damaging 1.00
R4962:Nlrp6 UTSW 7 140,503,497 (GRCm39) missense probably damaging 0.99
R5436:Nlrp6 UTSW 7 140,502,630 (GRCm39) nonsense probably null
R5442:Nlrp6 UTSW 7 140,502,103 (GRCm39) missense probably benign 0.01
R5924:Nlrp6 UTSW 7 140,503,403 (GRCm39) missense probably damaging 1.00
R6124:Nlrp6 UTSW 7 140,503,160 (GRCm39) missense probably damaging 1.00
R6455:Nlrp6 UTSW 7 140,507,422 (GRCm39) missense possibly damaging 0.65
R6480:Nlrp6 UTSW 7 140,507,356 (GRCm39) missense possibly damaging 0.93
R6873:Nlrp6 UTSW 7 140,503,433 (GRCm39) missense probably benign 0.01
R7061:Nlrp6 UTSW 7 140,502,780 (GRCm39) missense probably benign 0.36
R7350:Nlrp6 UTSW 7 140,501,191 (GRCm39) start gained probably benign
R7532:Nlrp6 UTSW 7 140,505,097 (GRCm39) missense probably benign 0.00
R7752:Nlrp6 UTSW 7 140,507,353 (GRCm39) missense possibly damaging 0.92
R7901:Nlrp6 UTSW 7 140,507,353 (GRCm39) missense possibly damaging 0.92
R8098:Nlrp6 UTSW 7 140,503,168 (GRCm39) missense probably damaging 1.00
R8381:Nlrp6 UTSW 7 140,503,754 (GRCm39) missense possibly damaging 0.47
R8513:Nlrp6 UTSW 7 140,502,743 (GRCm39) missense possibly damaging 0.83
R9114:Nlrp6 UTSW 7 140,506,332 (GRCm39) missense probably damaging 1.00
V7732:Nlrp6 UTSW 7 140,506,561 (GRCm39) splice site probably benign
Z1176:Nlrp6 UTSW 7 140,502,634 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGAAGAGAGCTCGCAGC -3'
(R):5'- AGTCACTAGCAAGCGAGCTC -3'

Sequencing Primer
(F):5'- AGCCGCTGACCGTGGTG -3'
(R):5'- TAGCAAGCGAGCTCCTGGTAAC -3'
Posted On 2017-02-28