Incidental Mutation 'R5936:Nlrp6'
ID462262
Institutional Source Beutler Lab
Gene Symbol Nlrp6
Ensembl Gene ENSMUSG00000038745
Gene NameNLR family, pyrin domain containing 6
SynonymsNalp6
MMRRC Submission 044130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5936 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140920902-140929192 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 140922812 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 277 (L277*)
Ref Sequence ENSEMBL: ENSMUSP00000139170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]
Predicted Effect probably null
Transcript: ENSMUST00000106045
AA Change: L247*
SMART Domains Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: L247*

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 8.6e-44 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 675 697 N/A INTRINSIC
internal_repeat_1 715 763 9.43e-6 PROSPERO
internal_repeat_1 828 876 9.43e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183761
Predicted Effect probably null
Transcript: ENSMUST00000183845
AA Change: L247*
SMART Domains Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: L247*

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 5.5e-43 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
internal_repeat_1 702 750 1.26e-5 PROSPERO
internal_repeat_1 815 863 1.26e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000184560
AA Change: L277*
SMART Domains Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: L277*

DomainStartEndE-ValueType
PYRIN 45 126 5.44e-27 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:NACHT 224 393 8.2e-43 PFAM
coiled coil region 620 647 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
internal_repeat_1 732 780 1.55e-5 PROSPERO
internal_repeat_1 845 893 1.55e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 91% (77/85)
MGI Phenotype FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,504 probably benign Het
Acnat2 T C 4: 49,383,362 T64A probably benign Het
Afap1 A G 5: 35,974,396 N356D possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Ankrd46 T C 15: 36,479,282 D221G probably benign Het
Ano6 T A 15: 95,972,601 L900H probably damaging Het
Asphd2 G A 5: 112,385,757 R343* probably null Het
BC055324 T G 1: 163,987,012 I121L probably benign Het
Brdt A G 5: 107,359,395 T554A probably damaging Het
Cacna1d A G 14: 30,171,314 V401A possibly damaging Het
Cbs T C 17: 31,625,094 T188A probably damaging Het
Cfap54 T A 10: 92,962,412 T1662S probably benign Het
Chka A G 19: 3,884,580 I205V probably benign Het
Chsy1 T A 7: 66,172,277 N753K possibly damaging Het
Cpz A G 5: 35,502,643 S553P probably benign Het
Crtac1 A G 19: 42,323,837 Y146H probably damaging Het
Csf1r A T 18: 61,125,808 I700F probably damaging Het
Ddx20 C A 3: 105,680,587 E392D possibly damaging Het
Dhrs11 G T 11: 84,825,524 Y67* probably null Het
Diaph3 G T 14: 86,772,116 Q1076K possibly damaging Het
Dopey1 T A 9: 86,536,512 L2037* probably null Het
Dst G T 1: 34,307,458 V5336L probably damaging Het
Etv1 C A 12: 38,835,210 H248Q probably damaging Het
Fam214a T C 9: 75,009,304 L395P probably benign Het
Fcgbp T C 7: 28,086,692 V518A probably damaging Het
Fchsd2 T C 7: 101,191,701 L139S probably damaging Het
Fer A T 17: 63,924,063 T270S probably benign Het
Fgd5 A G 6: 91,987,911 E375G probably damaging Het
Gabarapl1 T A 6: 129,538,603 I68N probably benign Het
Gopc C T 10: 52,346,199 V30M probably damaging Het
Hbp1 T C 12: 31,937,096 probably null Het
Helz2 A G 2: 181,230,767 V2480A probably damaging Het
Igfbp3 T A 11: 7,209,472 Y247F probably damaging Het
Kbtbd11 C A 8: 15,027,534 S44R probably benign Het
Kcnk10 G T 12: 98,489,932 S213R probably benign Het
Kcnq3 T A 15: 66,000,110 D570V probably damaging Het
Kif21a A G 15: 90,935,647 F1594S possibly damaging Het
Klf3 A G 5: 64,822,960 D31G probably damaging Het
Mapkapk3 T C 9: 107,289,170 K59E probably damaging Het
Myo18a A G 11: 77,818,213 T484A probably damaging Het
Nr5a1 G T 2: 38,701,778 probably benign Het
Nsmaf C T 4: 6,421,017 probably benign Het
Olfr1311 T A 2: 112,021,587 H89L probably benign Het
Orc1 A G 4: 108,601,983 T450A probably benign Het
Pacsin1 A T 17: 27,704,997 I122F probably benign Het
Pced1b T A 15: 97,385,180 Y367N possibly damaging Het
Pced1b T A 15: 97,385,182 Y367* probably null Het
Pdpk1 A G 17: 24,093,229 F281L probably damaging Het
Piwil1 T C 5: 128,751,078 V714A probably benign Het
Plcd3 C T 11: 103,078,347 V265M probably damaging Het
Ppp1r1c A T 2: 79,756,454 E48V possibly damaging Het
Prl2b1 T G 13: 27,388,449 T53P probably damaging Het
Ptch2 T G 4: 117,108,294 F359V probably benign Het
R3hdm2 G A 10: 127,471,812 S314N probably damaging Het
Rictor A T 15: 6,784,161 S1043C probably damaging Het
Rtn4rl2 A T 2: 84,880,431 L163Q probably damaging Het
Sarnp T A 10: 128,848,771 S129T probably benign Het
Scube3 A T 17: 28,165,487 K585M probably damaging Het
Sgk3 C T 1: 9,885,820 probably benign Het
Skint6 C T 4: 113,096,593 S458N probably benign Het
Slc25a54 A G 3: 109,098,638 H154R possibly damaging Het
Sorbs1 A C 19: 40,324,772 I690S probably damaging Het
Sqle C A 15: 59,330,829 A512D probably damaging Het
Tedc2 A C 17: 24,216,341 L358R probably damaging Het
Tfr2 A G 5: 137,587,006 S767G probably benign Het
Thoc5 A G 11: 4,904,133 E27G probably damaging Het
Trappc8 A T 18: 20,874,688 F123L probably damaging Het
Ube2cbp C T 9: 86,372,459 G323D probably benign Het
Unc13c T A 9: 73,578,492 H1642L probably damaging Het
Vmn1r10 A T 6: 57,114,317 H298L probably benign Het
Xpo4 A T 14: 57,643,499 Y26N probably benign Het
Zer1 A G 2: 30,107,667 L409P probably damaging Het
Zfyve28 A T 5: 34,224,988 L256Q probably damaging Het
Zgrf1 A G 3: 127,562,253 E376G possibly damaging Het
Other mutations in Nlrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Nlrp6 APN 7 140923124 missense probably damaging 1.00
IGL01066:Nlrp6 APN 7 140921796 missense possibly damaging 0.88
IGL01966:Nlrp6 APN 7 140925190 missense probably damaging 1.00
IGL02625:Nlrp6 APN 7 140923500 missense probably benign 0.00
IGL02792:Nlrp6 APN 7 140922435 missense probably damaging 0.97
IGL02813:Nlrp6 APN 7 140923420 missense possibly damaging 0.86
IGL03140:Nlrp6 APN 7 140927487 missense probably benign 0.01
R0608:Nlrp6 UTSW 7 140923486 nonsense probably null
R1404:Nlrp6 UTSW 7 140924113 small deletion probably benign
R1404:Nlrp6 UTSW 7 140924113 small deletion probably benign
R1472:Nlrp6 UTSW 7 140923495 missense probably damaging 1.00
R1587:Nlrp6 UTSW 7 140923046 missense probably damaging 1.00
R1843:Nlrp6 UTSW 7 140923093 missense probably damaging 1.00
R1959:Nlrp6 UTSW 7 140924113 small deletion probably benign
R2097:Nlrp6 UTSW 7 140923204 missense probably damaging 1.00
R2118:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2119:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2120:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2121:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2290:Nlrp6 UTSW 7 140922163 missense probably damaging 1.00
R3546:Nlrp6 UTSW 7 140926769 missense probably benign 0.00
R3547:Nlrp6 UTSW 7 140926769 missense probably benign 0.00
R3970:Nlrp6 UTSW 7 140921655 missense probably damaging 1.00
R4483:Nlrp6 UTSW 7 140921781 missense probably damaging 1.00
R4484:Nlrp6 UTSW 7 140921781 missense probably damaging 1.00
R4869:Nlrp6 UTSW 7 140924093 missense probably damaging 1.00
R4962:Nlrp6 UTSW 7 140923584 missense probably damaging 0.99
R5436:Nlrp6 UTSW 7 140922717 nonsense probably null
R5442:Nlrp6 UTSW 7 140922190 missense probably benign 0.01
R5924:Nlrp6 UTSW 7 140923490 missense probably damaging 1.00
R6124:Nlrp6 UTSW 7 140923247 missense probably damaging 1.00
R6455:Nlrp6 UTSW 7 140927509 missense possibly damaging 0.65
R6480:Nlrp6 UTSW 7 140927443 missense possibly damaging 0.93
R6873:Nlrp6 UTSW 7 140923520 missense probably benign 0.01
R7061:Nlrp6 UTSW 7 140922867 missense probably benign 0.36
R7350:Nlrp6 UTSW 7 140921278 start gained probably benign
R7532:Nlrp6 UTSW 7 140925184 missense probably benign 0.00
R7752:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R7901:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R7984:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R8098:Nlrp6 UTSW 7 140923255 missense probably damaging 1.00
V7732:Nlrp6 UTSW 7 140926648 splice site probably benign
Z1176:Nlrp6 UTSW 7 140922721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGAAGAGAGCTCGCAGC -3'
(R):5'- AGTCACTAGCAAGCGAGCTC -3'

Sequencing Primer
(F):5'- AGCCGCTGACCGTGGTG -3'
(R):5'- TAGCAAGCGAGCTCCTGGTAAC -3'
Posted On2017-02-28