Incidental Mutation 'R5936:Mapkapk3'
ID462268
Institutional Source Beutler Lab
Gene Symbol Mapkapk3
Ensembl Gene ENSMUSG00000032577
Gene Namemitogen-activated protein kinase-activated protein kinase 3
SynonymsMK3
MMRRC Submission 044130-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5936 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107254927-107289877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107289170 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 59 (K59E)
Ref Sequence ENSEMBL: ENSMUSP00000141342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035194] [ENSMUST00000192054]
Predicted Effect probably damaging
Transcript: ENSMUST00000035194
AA Change: K59E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035194
Gene: ENSMUSG00000032577
AA Change: K59E

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
S_TKc 45 306 4.97e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170597
Predicted Effect probably damaging
Transcript: ENSMUST00000192054
AA Change: K59E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141342
Gene: ENSMUSG00000032577
AA Change: K59E

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
Pfam:Pkinase 46 264 6.3e-48 PFAM
Pfam:Pkinase_Tyr 47 259 1.1e-27 PFAM
Pfam:Kdo 80 202 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 91% (77/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family. This kinase functions as a mitogen-activated protein kinase (MAP kinase)- activated protein kinase. MAP kinases are also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This kinase was shown to be activated by growth inducers and stress stimulation of cells. In vitro studies demonstrated that ERK, p38 MAP kinase and Jun N-terminal kinase were all able to phosphorylate and activate this kinase, which suggested the role of this kinase as an integrative element of signaling in both mitogen and stress responses. This kinase was reported to interact with, phosphorylate and repress the activity of E47, which is a basic helix-loop-helix transcription factor known to be involved in the regulation of tissue-specific gene expression and cell differentiation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display normal tissue morphology, behavior, and LPS-induced production of cytokines. Eyes of homozygous null mice show defects in Bruch's membrane, with disorganized architecture and variability in thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,504 probably benign Het
Acnat2 T C 4: 49,383,362 T64A probably benign Het
Afap1 A G 5: 35,974,396 N356D possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Ankrd46 T C 15: 36,479,282 D221G probably benign Het
Ano6 T A 15: 95,972,601 L900H probably damaging Het
Asphd2 G A 5: 112,385,757 R343* probably null Het
BC055324 T G 1: 163,987,012 I121L probably benign Het
Brdt A G 5: 107,359,395 T554A probably damaging Het
Cacna1d A G 14: 30,171,314 V401A possibly damaging Het
Cbs T C 17: 31,625,094 T188A probably damaging Het
Cfap54 T A 10: 92,962,412 T1662S probably benign Het
Chka A G 19: 3,884,580 I205V probably benign Het
Chsy1 T A 7: 66,172,277 N753K possibly damaging Het
Cpz A G 5: 35,502,643 S553P probably benign Het
Crtac1 A G 19: 42,323,837 Y146H probably damaging Het
Csf1r A T 18: 61,125,808 I700F probably damaging Het
Ddx20 C A 3: 105,680,587 E392D possibly damaging Het
Dhrs11 G T 11: 84,825,524 Y67* probably null Het
Diaph3 G T 14: 86,772,116 Q1076K possibly damaging Het
Dopey1 T A 9: 86,536,512 L2037* probably null Het
Dst G T 1: 34,307,458 V5336L probably damaging Het
Etv1 C A 12: 38,835,210 H248Q probably damaging Het
Fam214a T C 9: 75,009,304 L395P probably benign Het
Fcgbp T C 7: 28,086,692 V518A probably damaging Het
Fchsd2 T C 7: 101,191,701 L139S probably damaging Het
Fer A T 17: 63,924,063 T270S probably benign Het
Fgd5 A G 6: 91,987,911 E375G probably damaging Het
Gabarapl1 T A 6: 129,538,603 I68N probably benign Het
Gopc C T 10: 52,346,199 V30M probably damaging Het
Hbp1 T C 12: 31,937,096 probably null Het
Helz2 A G 2: 181,230,767 V2480A probably damaging Het
Igfbp3 T A 11: 7,209,472 Y247F probably damaging Het
Kbtbd11 C A 8: 15,027,534 S44R probably benign Het
Kcnk10 G T 12: 98,489,932 S213R probably benign Het
Kcnq3 T A 15: 66,000,110 D570V probably damaging Het
Kif21a A G 15: 90,935,647 F1594S possibly damaging Het
Klf3 A G 5: 64,822,960 D31G probably damaging Het
Myo18a A G 11: 77,818,213 T484A probably damaging Het
Nlrp6 T A 7: 140,922,812 L277* probably null Het
Nr5a1 G T 2: 38,701,778 probably benign Het
Nsmaf C T 4: 6,421,017 probably benign Het
Olfr1311 T A 2: 112,021,587 H89L probably benign Het
Orc1 A G 4: 108,601,983 T450A probably benign Het
Pacsin1 A T 17: 27,704,997 I122F probably benign Het
Pced1b T A 15: 97,385,180 Y367N possibly damaging Het
Pced1b T A 15: 97,385,182 Y367* probably null Het
Pdpk1 A G 17: 24,093,229 F281L probably damaging Het
Piwil1 T C 5: 128,751,078 V714A probably benign Het
Plcd3 C T 11: 103,078,347 V265M probably damaging Het
Ppp1r1c A T 2: 79,756,454 E48V possibly damaging Het
Prl2b1 T G 13: 27,388,449 T53P probably damaging Het
Ptch2 T G 4: 117,108,294 F359V probably benign Het
R3hdm2 G A 10: 127,471,812 S314N probably damaging Het
Rictor A T 15: 6,784,161 S1043C probably damaging Het
Rtn4rl2 A T 2: 84,880,431 L163Q probably damaging Het
Sarnp T A 10: 128,848,771 S129T probably benign Het
Scube3 A T 17: 28,165,487 K585M probably damaging Het
Sgk3 C T 1: 9,885,820 probably benign Het
Skint6 C T 4: 113,096,593 S458N probably benign Het
Slc25a54 A G 3: 109,098,638 H154R possibly damaging Het
Sorbs1 A C 19: 40,324,772 I690S probably damaging Het
Sqle C A 15: 59,330,829 A512D probably damaging Het
Tedc2 A C 17: 24,216,341 L358R probably damaging Het
Tfr2 A G 5: 137,587,006 S767G probably benign Het
Thoc5 A G 11: 4,904,133 E27G probably damaging Het
Trappc8 A T 18: 20,874,688 F123L probably damaging Het
Ube2cbp C T 9: 86,372,459 G323D probably benign Het
Unc13c T A 9: 73,578,492 H1642L probably damaging Het
Vmn1r10 A T 6: 57,114,317 H298L probably benign Het
Xpo4 A T 14: 57,643,499 Y26N probably benign Het
Zer1 A G 2: 30,107,667 L409P probably damaging Het
Zfyve28 A T 5: 34,224,988 L256Q probably damaging Het
Zgrf1 A G 3: 127,562,253 E376G possibly damaging Het
Other mutations in Mapkapk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Mapkapk3 APN 9 107262422 critical splice donor site probably null
IGL02486:Mapkapk3 APN 9 107289268 missense probably damaging 1.00
IGL02971:Mapkapk3 APN 9 107257080 missense probably benign 0.00
R1523:Mapkapk3 UTSW 9 107263623 critical splice donor site probably null
R4106:Mapkapk3 UTSW 9 107257066 missense probably damaging 0.99
R4290:Mapkapk3 UTSW 9 107258932 intron probably benign
R4291:Mapkapk3 UTSW 9 107258932 intron probably benign
R4293:Mapkapk3 UTSW 9 107258932 intron probably benign
R4294:Mapkapk3 UTSW 9 107258932 intron probably benign
R4299:Mapkapk3 UTSW 9 107257449 missense probably damaging 1.00
R5433:Mapkapk3 UTSW 9 107256292 missense probably damaging 0.96
R6029:Mapkapk3 UTSW 9 107289226 missense possibly damaging 0.86
R6228:Mapkapk3 UTSW 9 107260063 missense probably damaging 1.00
R6520:Mapkapk3 UTSW 9 107257449 missense probably damaging 1.00
R7011:Mapkapk3 UTSW 9 107289396 unclassified probably benign
R7352:Mapkapk3 UTSW 9 107257070 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CTGACGCTAGAGGAAGAGTTTG -3'
(R):5'- GGGGAGTGACTCTTTCCCTTTC -3'

Sequencing Primer
(F):5'- TGAAAATAAAACAAGATGCCATGTG -3'
(R):5'- TTCAGGTGCCTCTGGACG -3'
Posted On2017-02-28