Incidental Mutation 'R5936:Diaph3'
ID462285
Institutional Source Beutler Lab
Gene Symbol Diaph3
Ensembl Gene ENSMUSG00000022021
Gene Namediaphanous related formin 3
Synonyms4930417P13Rik, Diap3, mDia2, p134MDia2, Drf3
MMRRC Submission 044130-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5936 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location86655367-87141235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86772116 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1076 (Q1076K)
Ref Sequence ENSEMBL: ENSMUSP00000022599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022599] [ENSMUST00000168889]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022599
AA Change: Q1076K

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022599
Gene: ENSMUSG00000022021
AA Change: Q1076K

DomainStartEndE-ValueType
low complexity region 76 86 N/A INTRINSIC
Drf_GBD 93 276 7.94e-61 SMART
Drf_FH3 281 467 5.74e-67 SMART
coiled coil region 485 533 N/A INTRINSIC
SCOP:d1jvr__ 545 589 1e-3 SMART
FH2 615 1056 3.88e-180 SMART
Blast:FH2 1087 1160 2e-27 BLAST
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168889
AA Change: Q1076K

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129420
Gene: ENSMUSG00000022021
AA Change: Q1076K

DomainStartEndE-ValueType
low complexity region 76 86 N/A INTRINSIC
Drf_GBD 93 276 7.94e-61 SMART
Drf_FH3 281 467 5.74e-67 SMART
coiled coil region 485 533 N/A INTRINSIC
SCOP:d1jvr__ 545 589 1e-3 SMART
FH2 615 1056 3.2e-181 SMART
Blast:FH2 1087 1160 2e-27 BLAST
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227666
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 91% (77/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in this gene are associated with autosomal dominant auditory neuropathy 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for disruption of this gene display embryonic mortality and abnormal cytokinesis of RBC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,504 probably benign Het
Acnat2 T C 4: 49,383,362 T64A probably benign Het
Afap1 A G 5: 35,974,396 N356D possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Ankrd46 T C 15: 36,479,282 D221G probably benign Het
Ano6 T A 15: 95,972,601 L900H probably damaging Het
Asphd2 G A 5: 112,385,757 R343* probably null Het
BC055324 T G 1: 163,987,012 I121L probably benign Het
Brdt A G 5: 107,359,395 T554A probably damaging Het
Cacna1d A G 14: 30,171,314 V401A possibly damaging Het
Cbs T C 17: 31,625,094 T188A probably damaging Het
Cfap54 T A 10: 92,962,412 T1662S probably benign Het
Chka A G 19: 3,884,580 I205V probably benign Het
Chsy1 T A 7: 66,172,277 N753K possibly damaging Het
Cpz A G 5: 35,502,643 S553P probably benign Het
Crtac1 A G 19: 42,323,837 Y146H probably damaging Het
Csf1r A T 18: 61,125,808 I700F probably damaging Het
Ddx20 C A 3: 105,680,587 E392D possibly damaging Het
Dhrs11 G T 11: 84,825,524 Y67* probably null Het
Dopey1 T A 9: 86,536,512 L2037* probably null Het
Dst G T 1: 34,307,458 V5336L probably damaging Het
Etv1 C A 12: 38,835,210 H248Q probably damaging Het
Fam214a T C 9: 75,009,304 L395P probably benign Het
Fcgbp T C 7: 28,086,692 V518A probably damaging Het
Fchsd2 T C 7: 101,191,701 L139S probably damaging Het
Fer A T 17: 63,924,063 T270S probably benign Het
Fgd5 A G 6: 91,987,911 E375G probably damaging Het
Gabarapl1 T A 6: 129,538,603 I68N probably benign Het
Gopc C T 10: 52,346,199 V30M probably damaging Het
Hbp1 T C 12: 31,937,096 probably null Het
Helz2 A G 2: 181,230,767 V2480A probably damaging Het
Igfbp3 T A 11: 7,209,472 Y247F probably damaging Het
Kbtbd11 C A 8: 15,027,534 S44R probably benign Het
Kcnk10 G T 12: 98,489,932 S213R probably benign Het
Kcnq3 T A 15: 66,000,110 D570V probably damaging Het
Kif21a A G 15: 90,935,647 F1594S possibly damaging Het
Klf3 A G 5: 64,822,960 D31G probably damaging Het
Mapkapk3 T C 9: 107,289,170 K59E probably damaging Het
Myo18a A G 11: 77,818,213 T484A probably damaging Het
Nlrp6 T A 7: 140,922,812 L277* probably null Het
Nr5a1 G T 2: 38,701,778 probably benign Het
Nsmaf C T 4: 6,421,017 probably benign Het
Olfr1311 T A 2: 112,021,587 H89L probably benign Het
Orc1 A G 4: 108,601,983 T450A probably benign Het
Pacsin1 A T 17: 27,704,997 I122F probably benign Het
Pced1b T A 15: 97,385,180 Y367N possibly damaging Het
Pced1b T A 15: 97,385,182 Y367* probably null Het
Pdpk1 A G 17: 24,093,229 F281L probably damaging Het
Piwil1 T C 5: 128,751,078 V714A probably benign Het
Plcd3 C T 11: 103,078,347 V265M probably damaging Het
Ppp1r1c A T 2: 79,756,454 E48V possibly damaging Het
Prl2b1 T G 13: 27,388,449 T53P probably damaging Het
Ptch2 T G 4: 117,108,294 F359V probably benign Het
R3hdm2 G A 10: 127,471,812 S314N probably damaging Het
Rictor A T 15: 6,784,161 S1043C probably damaging Het
Rtn4rl2 A T 2: 84,880,431 L163Q probably damaging Het
Sarnp T A 10: 128,848,771 S129T probably benign Het
Scube3 A T 17: 28,165,487 K585M probably damaging Het
Sgk3 C T 1: 9,885,820 probably benign Het
Skint6 C T 4: 113,096,593 S458N probably benign Het
Slc25a54 A G 3: 109,098,638 H154R possibly damaging Het
Sorbs1 A C 19: 40,324,772 I690S probably damaging Het
Sqle C A 15: 59,330,829 A512D probably damaging Het
Tedc2 A C 17: 24,216,341 L358R probably damaging Het
Tfr2 A G 5: 137,587,006 S767G probably benign Het
Thoc5 A G 11: 4,904,133 E27G probably damaging Het
Trappc8 A T 18: 20,874,688 F123L probably damaging Het
Ube2cbp C T 9: 86,372,459 G323D probably benign Het
Unc13c T A 9: 73,578,492 H1642L probably damaging Het
Vmn1r10 A T 6: 57,114,317 H298L probably benign Het
Xpo4 A T 14: 57,643,499 Y26N probably benign Het
Zer1 A G 2: 30,107,667 L409P probably damaging Het
Zfyve28 A T 5: 34,224,988 L256Q probably damaging Het
Zgrf1 A G 3: 127,562,253 E376G possibly damaging Het
Other mutations in Diaph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Diaph3 APN 14 87002871 missense probably benign
IGL00809:Diaph3 APN 14 87000027 missense probably damaging 0.98
IGL01419:Diaph3 APN 14 86965553 nonsense probably null
IGL01577:Diaph3 APN 14 86906031 missense probably damaging 0.99
IGL01718:Diaph3 APN 14 86656338 missense unknown
IGL01736:Diaph3 APN 14 86918846 missense probably benign 0.01
IGL01893:Diaph3 APN 14 86918852 missense possibly damaging 0.71
IGL02316:Diaph3 APN 14 86986115 missense possibly damaging 0.88
IGL02527:Diaph3 APN 14 86810359 missense possibly damaging 0.47
IGL02586:Diaph3 APN 14 86986076 nonsense probably null
IGL02749:Diaph3 APN 14 86918825 missense probably damaging 0.99
IGL02892:Diaph3 APN 14 86866630 nonsense probably null
IGL03069:Diaph3 APN 14 86772119 missense probably damaging 1.00
IGL03191:Diaph3 APN 14 87073302 missense possibly damaging 0.75
R0007:Diaph3 UTSW 14 86866620 missense possibly damaging 0.86
R0007:Diaph3 UTSW 14 86866620 missense possibly damaging 0.86
R0011:Diaph3 UTSW 14 86866408 missense probably damaging 1.00
R0051:Diaph3 UTSW 14 87037454 critical splice donor site probably null
R0051:Diaph3 UTSW 14 87037454 critical splice donor site probably null
R0285:Diaph3 UTSW 14 87115024 missense possibly damaging 0.86
R0359:Diaph3 UTSW 14 86969502 missense probably benign 0.26
R0505:Diaph3 UTSW 14 87090964 splice site probably benign
R0551:Diaph3 UTSW 14 86910100 missense probably benign 0.45
R1295:Diaph3 UTSW 14 87007399 missense probably damaging 1.00
R1539:Diaph3 UTSW 14 86656480 missense probably damaging 1.00
R1602:Diaph3 UTSW 14 87091158 splice site probably benign
R1725:Diaph3 UTSW 14 86966323 critical splice donor site probably null
R1745:Diaph3 UTSW 14 86966560 missense probably damaging 0.96
R1747:Diaph3 UTSW 14 87073337 missense probably damaging 0.98
R1772:Diaph3 UTSW 14 86965549 missense probably damaging 1.00
R1914:Diaph3 UTSW 14 86656485 missense probably damaging 0.98
R1942:Diaph3 UTSW 14 87141120 utr 5 prime probably benign
R1999:Diaph3 UTSW 14 86984866 missense possibly damaging 0.53
R2291:Diaph3 UTSW 14 86966446 missense probably damaging 1.00
R2999:Diaph3 UTSW 14 86772094 missense probably damaging 0.99
R3158:Diaph3 UTSW 14 86656456 missense possibly damaging 0.84
R3612:Diaph3 UTSW 14 87037457 missense probably null 0.89
R4170:Diaph3 UTSW 14 86985707 missense probably damaging 1.00
R4594:Diaph3 UTSW 14 86986037 missense probably damaging 0.99
R4912:Diaph3 UTSW 14 87007199 missense probably damaging 1.00
R4930:Diaph3 UTSW 14 87141166 start gained probably benign
R5063:Diaph3 UTSW 14 86984870 missense probably damaging 1.00
R5093:Diaph3 UTSW 14 86984800 missense probably damaging 1.00
R5267:Diaph3 UTSW 14 86656553 missense probably benign 0.03
R5289:Diaph3 UTSW 14 86981678 missense probably damaging 1.00
R5549:Diaph3 UTSW 14 86978670 missense probably benign 0.14
R5966:Diaph3 UTSW 14 86984825 missense probably damaging 1.00
R6236:Diaph3 UTSW 14 87037568 nonsense probably null
R6323:Diaph3 UTSW 14 86966453 missense probably benign 0.03
R6331:Diaph3 UTSW 14 86866540 missense probably damaging 1.00
R6362:Diaph3 UTSW 14 86772130 missense probably damaging 1.00
R6398:Diaph3 UTSW 14 86866486 missense probably damaging 1.00
R6408:Diaph3 UTSW 14 86828994 missense possibly damaging 0.68
R6469:Diaph3 UTSW 14 86656538 missense possibly damaging 0.71
R6519:Diaph3 UTSW 14 86966335 missense probably damaging 1.00
R7261:Diaph3 UTSW 14 86965457 missense probably benign 0.04
R7283:Diaph3 UTSW 14 86866584 missense probably damaging 1.00
R7782:Diaph3 UTSW 14 87037504 missense probably benign 0.00
R7811:Diaph3 UTSW 14 86981624 missense probably damaging 1.00
R8012:Diaph3 UTSW 14 87037522 missense not run
R8024:Diaph3 UTSW 14 86656399 missense not run
R8065:Diaph3 UTSW 14 87037495 missense not run
Z1176:Diaph3 UTSW 14 86656432 missense not run
Z1177:Diaph3 UTSW 14 87002814 missense not run
Predicted Primers PCR Primer
(F):5'- GGAAAACAGAGCCCGTCATC -3'
(R):5'- GGTTAGCGTCCCACAGTTAAATG -3'

Sequencing Primer
(F):5'- AGAGCCCGTCATCTCAGAG -3'
(R):5'- GGGTAAAAGTCCAAGCATCACTGTTC -3'
Posted On2017-02-28