Incidental Mutation 'R5936:Cbs'
ID462297
Institutional Source Beutler Lab
Gene Symbol Cbs
Ensembl Gene ENSMUSG00000024039
Gene Namecystathionine beta-synthase
SynonymsHIP4
MMRRC Submission 044130-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R5936 (G1)
Quality Score197
Status Validated
Chromosome17
Chromosomal Location31612623-31637199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31625094 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 188 (T188A)
Ref Sequence ENSEMBL: ENSMUSP00000113209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067801] [ENSMUST00000078509] [ENSMUST00000118504] [ENSMUST00000135425] [ENSMUST00000151718] [ENSMUST00000155814]
Predicted Effect probably damaging
Transcript: ENSMUST00000067801
AA Change: T188A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066878
Gene: ENSMUSG00000024039
AA Change: T188A

DomainStartEndE-ValueType
Pfam:PALP 77 373 3.7e-66 PFAM
CBS 417 465 5.9e-11 SMART
Blast:CBS 482 553 1e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000078509
AA Change: T188A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077597
Gene: ENSMUSG00000024039
AA Change: T188A

DomainStartEndE-ValueType
Pfam:PALP 77 373 3.4e-64 PFAM
CBS 417 465 1.19e-8 SMART
Blast:CBS 483 539 2e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000118504
AA Change: T188A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113209
Gene: ENSMUSG00000024039
AA Change: T188A

DomainStartEndE-ValueType
Pfam:PALP 77 373 3.4e-64 PFAM
CBS 417 465 1.19e-8 SMART
Blast:CBS 483 539 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128351
Predicted Effect probably benign
Transcript: ENSMUST00000135425
SMART Domains Protein: ENSMUSP00000118785
Gene: ENSMUSG00000024039

DomainStartEndE-ValueType
Pfam:PALP 77 175 4.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143982
Predicted Effect probably benign
Transcript: ENSMUST00000151718
SMART Domains Protein: ENSMUSP00000117454
Gene: ENSMUSG00000024039

DomainStartEndE-ValueType
PDB:4COO|B 1 86 2e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000155814
AA Change: T188A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118472
Gene: ENSMUSG00000024039
AA Change: T188A

DomainStartEndE-ValueType
Pfam:PALP 77 193 2.3e-32 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 91% (77/85)
MGI Phenotype PHENOTYPE: Homozygous targeted mutants are severely growth retarded and die within 5 weeks of birth with enlarged multinucleate hepatocytes filled with lipid and massively elevated plasma homocysteine levels. Heterozygotes have twice normal homocysteine levels, butsurvive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,504 probably benign Het
Acnat2 T C 4: 49,383,362 T64A probably benign Het
Afap1 A G 5: 35,974,396 N356D possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Ankrd46 T C 15: 36,479,282 D221G probably benign Het
Ano6 T A 15: 95,972,601 L900H probably damaging Het
Asphd2 G A 5: 112,385,757 R343* probably null Het
BC055324 T G 1: 163,987,012 I121L probably benign Het
Brdt A G 5: 107,359,395 T554A probably damaging Het
Cacna1d A G 14: 30,171,314 V401A possibly damaging Het
Cfap54 T A 10: 92,962,412 T1662S probably benign Het
Chka A G 19: 3,884,580 I205V probably benign Het
Chsy1 T A 7: 66,172,277 N753K possibly damaging Het
Cpz A G 5: 35,502,643 S553P probably benign Het
Crtac1 A G 19: 42,323,837 Y146H probably damaging Het
Csf1r A T 18: 61,125,808 I700F probably damaging Het
Ddx20 C A 3: 105,680,587 E392D possibly damaging Het
Dhrs11 G T 11: 84,825,524 Y67* probably null Het
Diaph3 G T 14: 86,772,116 Q1076K possibly damaging Het
Dopey1 T A 9: 86,536,512 L2037* probably null Het
Dst G T 1: 34,307,458 V5336L probably damaging Het
Etv1 C A 12: 38,835,210 H248Q probably damaging Het
Fam214a T C 9: 75,009,304 L395P probably benign Het
Fcgbp T C 7: 28,086,692 V518A probably damaging Het
Fchsd2 T C 7: 101,191,701 L139S probably damaging Het
Fer A T 17: 63,924,063 T270S probably benign Het
Fgd5 A G 6: 91,987,911 E375G probably damaging Het
Gabarapl1 T A 6: 129,538,603 I68N probably benign Het
Gopc C T 10: 52,346,199 V30M probably damaging Het
Hbp1 T C 12: 31,937,096 probably null Het
Helz2 A G 2: 181,230,767 V2480A probably damaging Het
Igfbp3 T A 11: 7,209,472 Y247F probably damaging Het
Kbtbd11 C A 8: 15,027,534 S44R probably benign Het
Kcnk10 G T 12: 98,489,932 S213R probably benign Het
Kcnq3 T A 15: 66,000,110 D570V probably damaging Het
Kif21a A G 15: 90,935,647 F1594S possibly damaging Het
Klf3 A G 5: 64,822,960 D31G probably damaging Het
Mapkapk3 T C 9: 107,289,170 K59E probably damaging Het
Myo18a A G 11: 77,818,213 T484A probably damaging Het
Nlrp6 T A 7: 140,922,812 L277* probably null Het
Nr5a1 G T 2: 38,701,778 probably benign Het
Nsmaf C T 4: 6,421,017 probably benign Het
Olfr1311 T A 2: 112,021,587 H89L probably benign Het
Orc1 A G 4: 108,601,983 T450A probably benign Het
Pacsin1 A T 17: 27,704,997 I122F probably benign Het
Pced1b T A 15: 97,385,180 Y367N possibly damaging Het
Pced1b T A 15: 97,385,182 Y367* probably null Het
Pdpk1 A G 17: 24,093,229 F281L probably damaging Het
Piwil1 T C 5: 128,751,078 V714A probably benign Het
Plcd3 C T 11: 103,078,347 V265M probably damaging Het
Ppp1r1c A T 2: 79,756,454 E48V possibly damaging Het
Prl2b1 T G 13: 27,388,449 T53P probably damaging Het
Ptch2 T G 4: 117,108,294 F359V probably benign Het
R3hdm2 G A 10: 127,471,812 S314N probably damaging Het
Rictor A T 15: 6,784,161 S1043C probably damaging Het
Rtn4rl2 A T 2: 84,880,431 L163Q probably damaging Het
Sarnp T A 10: 128,848,771 S129T probably benign Het
Scube3 A T 17: 28,165,487 K585M probably damaging Het
Sgk3 C T 1: 9,885,820 probably benign Het
Skint6 C T 4: 113,096,593 S458N probably benign Het
Slc25a54 A G 3: 109,098,638 H154R possibly damaging Het
Sorbs1 A C 19: 40,324,772 I690S probably damaging Het
Sqle C A 15: 59,330,829 A512D probably damaging Het
Tedc2 A C 17: 24,216,341 L358R probably damaging Het
Tfr2 A G 5: 137,587,006 S767G probably benign Het
Thoc5 A G 11: 4,904,133 E27G probably damaging Het
Trappc8 A T 18: 20,874,688 F123L probably damaging Het
Ube2cbp C T 9: 86,372,459 G323D probably benign Het
Unc13c T A 9: 73,578,492 H1642L probably damaging Het
Vmn1r10 A T 6: 57,114,317 H298L probably benign Het
Xpo4 A T 14: 57,643,499 Y26N probably benign Het
Zer1 A G 2: 30,107,667 L409P probably damaging Het
Zfyve28 A T 5: 34,224,988 L256Q probably damaging Het
Zgrf1 A G 3: 127,562,253 E376G possibly damaging Het
Other mutations in Cbs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Cbs APN 17 31621514 missense possibly damaging 0.90
IGL02030:Cbs APN 17 31625489 critical splice donor site probably null
IGL02089:Cbs APN 17 31615545 missense probably benign 0.13
IGL02274:Cbs APN 17 31625948 unclassified probably null
IGL02733:Cbs APN 17 31625031 missense probably benign 0.01
PIT4418001:Cbs UTSW 17 31615521 missense possibly damaging 0.89
R0334:Cbs UTSW 17 31619156 missense probably damaging 1.00
R0398:Cbs UTSW 17 31617242 missense probably benign 0.01
R0466:Cbs UTSW 17 31616152 missense probably benign
R0732:Cbs UTSW 17 31625029 missense probably benign 0.00
R1125:Cbs UTSW 17 31632831 missense probably benign 0.00
R1586:Cbs UTSW 17 31622474 missense probably damaging 1.00
R1646:Cbs UTSW 17 31613195 missense probably benign 0.00
R1728:Cbs UTSW 17 31620949 missense probably benign 0.35
R1729:Cbs UTSW 17 31620949 missense probably benign 0.35
R1784:Cbs UTSW 17 31620949 missense probably benign 0.35
R1823:Cbs UTSW 17 31624271 missense probably damaging 1.00
R2200:Cbs UTSW 17 31624264 missense probably damaging 1.00
R3829:Cbs UTSW 17 31617381 splice site probably benign
R3892:Cbs UTSW 17 31616074 missense probably benign 0.06
R4073:Cbs UTSW 17 31633005 missense possibly damaging 0.80
R4089:Cbs UTSW 17 31633006 missense probably benign 0.03
R4799:Cbs UTSW 17 31632852 missense probably damaging 0.99
R5029:Cbs UTSW 17 31615482 missense possibly damaging 0.85
R5194:Cbs UTSW 17 31624224 splice site probably null
R5244:Cbs UTSW 17 31617160 missense probably damaging 1.00
R5660:Cbs UTSW 17 31624246 missense probably damaging 1.00
R5890:Cbs UTSW 17 31613219 missense probably damaging 0.97
R5935:Cbs UTSW 17 31632879 missense probably damaging 0.98
R6891:Cbs UTSW 17 31622457 missense probably damaging 1.00
R7126:Cbs UTSW 17 31619139 missense probably benign 0.09
R7220:Cbs UTSW 17 31619217 missense probably benign 0.00
R7343:Cbs UTSW 17 31619139 missense possibly damaging 0.74
X0025:Cbs UTSW 17 31616137 missense possibly damaging 0.94
X0057:Cbs UTSW 17 31632970 missense probably benign 0.01
X0067:Cbs UTSW 17 31627555 missense probably damaging 1.00
Z1177:Cbs UTSW 17 31625882 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCCTCAGCTTTCCAACAGG -3'
(R):5'- CTGTGTGGCCTCTGCTTTAATAAAAG -3'

Sequencing Primer
(F):5'- TTTCCAACAGGGTCCCCTAGG -3'
(R):5'- AAAGCCTTTCTTTACCAACTAAAAAC -3'
Posted On2017-02-28