Incidental Mutation 'R5936:Trappc8'
ID462299
Institutional Source Beutler Lab
Gene Symbol Trappc8
Ensembl Gene ENSMUSG00000033382
Gene Nametrafficking protein particle complex 8
SynonymsD030074E01Rik, Trs85, 5033403J15Rik
MMRRC Submission 044130-MU
Accession Numbers

Genbank: NM_029491; MGI: 2443008

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5936 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20817223-20896093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20874688 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 123 (F123L)
Ref Sequence ENSEMBL: ENSMUSP00000153183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025177] [ENSMUST00000097658] [ENSMUST00000225661]
Predicted Effect probably damaging
Transcript: ENSMUST00000025177
AA Change: F123L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025177
Gene: ENSMUSG00000033382
AA Change: F123L

DomainStartEndE-ValueType
Pfam:TRAPPC-Trs85 157 604 1e-167 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097658
AA Change: F123L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095262
Gene: ENSMUSG00000033382
AA Change: F123L

DomainStartEndE-ValueType
Pfam:TRAPPC-Trs85 152 605 9.3e-135 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225661
AA Change: F123L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 91% (77/85)
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,504 probably benign Het
Acnat2 T C 4: 49,383,362 T64A probably benign Het
Afap1 A G 5: 35,974,396 N356D possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Ankrd46 T C 15: 36,479,282 D221G probably benign Het
Ano6 T A 15: 95,972,601 L900H probably damaging Het
Asphd2 G A 5: 112,385,757 R343* probably null Het
BC055324 T G 1: 163,987,012 I121L probably benign Het
Brdt A G 5: 107,359,395 T554A probably damaging Het
Cacna1d A G 14: 30,171,314 V401A possibly damaging Het
Cbs T C 17: 31,625,094 T188A probably damaging Het
Cfap54 T A 10: 92,962,412 T1662S probably benign Het
Chka A G 19: 3,884,580 I205V probably benign Het
Chsy1 T A 7: 66,172,277 N753K possibly damaging Het
Cpz A G 5: 35,502,643 S553P probably benign Het
Crtac1 A G 19: 42,323,837 Y146H probably damaging Het
Csf1r A T 18: 61,125,808 I700F probably damaging Het
Ddx20 C A 3: 105,680,587 E392D possibly damaging Het
Dhrs11 G T 11: 84,825,524 Y67* probably null Het
Diaph3 G T 14: 86,772,116 Q1076K possibly damaging Het
Dopey1 T A 9: 86,536,512 L2037* probably null Het
Dst G T 1: 34,307,458 V5336L probably damaging Het
Etv1 C A 12: 38,835,210 H248Q probably damaging Het
Fam214a T C 9: 75,009,304 L395P probably benign Het
Fcgbp T C 7: 28,086,692 V518A probably damaging Het
Fchsd2 T C 7: 101,191,701 L139S probably damaging Het
Fer A T 17: 63,924,063 T270S probably benign Het
Fgd5 A G 6: 91,987,911 E375G probably damaging Het
Gabarapl1 T A 6: 129,538,603 I68N probably benign Het
Gopc C T 10: 52,346,199 V30M probably damaging Het
Hbp1 T C 12: 31,937,096 probably null Het
Helz2 A G 2: 181,230,767 V2480A probably damaging Het
Igfbp3 T A 11: 7,209,472 Y247F probably damaging Het
Kbtbd11 C A 8: 15,027,534 S44R probably benign Het
Kcnk10 G T 12: 98,489,932 S213R probably benign Het
Kcnq3 T A 15: 66,000,110 D570V probably damaging Het
Kif21a A G 15: 90,935,647 F1594S possibly damaging Het
Klf3 A G 5: 64,822,960 D31G probably damaging Het
Mapkapk3 T C 9: 107,289,170 K59E probably damaging Het
Myo18a A G 11: 77,818,213 T484A probably damaging Het
Nlrp6 T A 7: 140,922,812 L277* probably null Het
Nr5a1 G T 2: 38,701,778 probably benign Het
Nsmaf C T 4: 6,421,017 probably benign Het
Olfr1311 T A 2: 112,021,587 H89L probably benign Het
Orc1 A G 4: 108,601,983 T450A probably benign Het
Pacsin1 A T 17: 27,704,997 I122F probably benign Het
Pced1b T A 15: 97,385,180 Y367N possibly damaging Het
Pced1b T A 15: 97,385,182 Y367* probably null Het
Pdpk1 A G 17: 24,093,229 F281L probably damaging Het
Piwil1 T C 5: 128,751,078 V714A probably benign Het
Plcd3 C T 11: 103,078,347 V265M probably damaging Het
Ppp1r1c A T 2: 79,756,454 E48V possibly damaging Het
Prl2b1 T G 13: 27,388,449 T53P probably damaging Het
Ptch2 T G 4: 117,108,294 F359V probably benign Het
R3hdm2 G A 10: 127,471,812 S314N probably damaging Het
Rictor A T 15: 6,784,161 S1043C probably damaging Het
Rtn4rl2 A T 2: 84,880,431 L163Q probably damaging Het
Sarnp T A 10: 128,848,771 S129T probably benign Het
Scube3 A T 17: 28,165,487 K585M probably damaging Het
Sgk3 C T 1: 9,885,820 probably benign Het
Skint6 C T 4: 113,096,593 S458N probably benign Het
Slc25a54 A G 3: 109,098,638 H154R possibly damaging Het
Sorbs1 A C 19: 40,324,772 I690S probably damaging Het
Sqle C A 15: 59,330,829 A512D probably damaging Het
Tedc2 A C 17: 24,216,341 L358R probably damaging Het
Tfr2 A G 5: 137,587,006 S767G probably benign Het
Thoc5 A G 11: 4,904,133 E27G probably damaging Het
Ube2cbp C T 9: 86,372,459 G323D probably benign Het
Unc13c T A 9: 73,578,492 H1642L probably damaging Het
Vmn1r10 A T 6: 57,114,317 H298L probably benign Het
Xpo4 A T 14: 57,643,499 Y26N probably benign Het
Zer1 A G 2: 30,107,667 L409P probably damaging Het
Zfyve28 A T 5: 34,224,988 L256Q probably damaging Het
Zgrf1 A G 3: 127,562,253 E376G possibly damaging Het
Other mutations in Trappc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Trappc8 APN 18 20836978 missense probably benign 0.20
IGL01367:Trappc8 APN 18 20866119 missense probably benign 0.01
IGL01537:Trappc8 APN 18 20835004 missense probably benign
IGL01563:Trappc8 APN 18 20837046 missense probably benign 0.00
IGL01982:Trappc8 APN 18 20874712 splice site probably benign
IGL02709:Trappc8 APN 18 20837178 missense possibly damaging 0.94
IGL03126:Trappc8 APN 18 20863595 missense probably damaging 1.00
IGL03290:Trappc8 APN 18 20820935 missense probably damaging 1.00
IGL03348:Trappc8 APN 18 20852781 missense probably damaging 1.00
hoppa UTSW 18 20836900 missense probably benign 0.05
Lagomorpha UTSW 18 20818190 missense probably benign 0.11
rabbit UTSW 18 20874680 missense probably damaging 1.00
E7848:Trappc8 UTSW 18 20850918 missense probably damaging 0.99
R0483:Trappc8 UTSW 18 20845601 missense possibly damaging 0.60
R0492:Trappc8 UTSW 18 20866186 missense probably benign 0.07
R0506:Trappc8 UTSW 18 20844188 missense possibly damaging 0.49
R0610:Trappc8 UTSW 18 20837188 missense probably damaging 1.00
R0892:Trappc8 UTSW 18 20831608 critical splice donor site probably null
R1561:Trappc8 UTSW 18 20841623 nonsense probably null
R1589:Trappc8 UTSW 18 20863551 missense probably damaging 1.00
R1700:Trappc8 UTSW 18 20832998 missense probably damaging 1.00
R1785:Trappc8 UTSW 18 20834940 splice site probably null
R1786:Trappc8 UTSW 18 20834940 splice site probably null
R1989:Trappc8 UTSW 18 20845651 missense probably benign 0.04
R2181:Trappc8 UTSW 18 20819222 critical splice donor site probably null
R2294:Trappc8 UTSW 18 20866154 nonsense probably null
R4551:Trappc8 UTSW 18 20874672 missense probably benign 0.10
R4594:Trappc8 UTSW 18 20836948 missense probably benign
R4631:Trappc8 UTSW 18 20867808 missense probably benign 0.22
R4734:Trappc8 UTSW 18 20841572 nonsense probably null
R4834:Trappc8 UTSW 18 20825065 missense probably damaging 0.99
R5114:Trappc8 UTSW 18 20844180 missense probably benign 0.04
R5262:Trappc8 UTSW 18 20818190 missense probably benign 0.11
R5384:Trappc8 UTSW 18 20833062 intron probably null
R5476:Trappc8 UTSW 18 20865108 missense probably damaging 1.00
R5503:Trappc8 UTSW 18 20836900 missense probably benign 0.05
R5577:Trappc8 UTSW 18 20836779 nonsense probably null
R5809:Trappc8 UTSW 18 20818082 missense probably benign 0.08
R5825:Trappc8 UTSW 18 20873920 missense probably damaging 1.00
R5886:Trappc8 UTSW 18 20874680 missense probably damaging 1.00
R6024:Trappc8 UTSW 18 20833009 missense probably damaging 0.98
R6105:Trappc8 UTSW 18 20846447 critical splice donor site probably null
R6229:Trappc8 UTSW 18 20870745 missense probably benign 0.00
R6376:Trappc8 UTSW 18 20837075 missense probably benign 0.07
R6403:Trappc8 UTSW 18 20866071 missense probably benign
R6459:Trappc8 UTSW 18 20836868 missense probably benign 0.40
R6673:Trappc8 UTSW 18 20885257 missense probably benign 0.01
R7041:Trappc8 UTSW 18 20874672 missense probably benign 0.10
R7276:Trappc8 UTSW 18 20818091 missense probably damaging 0.99
R7341:Trappc8 UTSW 18 20852647 missense probably damaging 1.00
R7684:Trappc8 UTSW 18 20863502 missense probably benign 0.01
R7702:Trappc8 UTSW 18 20825062 missense probably damaging 0.99
X0065:Trappc8 UTSW 18 20860522 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTGACCTTCATTTGCACAAAC -3'
(R):5'- AGGCTCAGGAGTGACACTTTC -3'

Sequencing Primer
(F):5'- GACCTTCATTTGCACAAACTTATAC -3'
(R):5'- GCTCAGGAGTGACACTTTCATTCTG -3'
Posted On2017-02-28