Incidental Mutation 'R5937:Pde6b'
ID462318
Institutional Source Beutler Lab
Gene Symbol Pde6b
Ensembl Gene ENSMUSG00000029491
Gene Namephosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonymsrd10, Pdeb, rd, rd1, r
MMRRC Submission 043242-MU
Accession Numbers

Genbank: NM_008806; MGI: 97525

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5937 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108388391-108432397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108424327 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 478 (A478S)
Ref Sequence ENSEMBL: ENSMUSP00000031456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031456]
Predicted Effect probably benign
Transcript: ENSMUST00000031456
AA Change: A478S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031456
Gene: ENSMUSG00000029491
AA Change: A478S

DomainStartEndE-ValueType
GAF 71 230 1.29e-27 SMART
GAF 252 439 5.76e-25 SMART
Blast:HDc 484 538 1e-24 BLAST
HDc 554 732 1.25e-9 SMART
Blast:HDc 757 792 8e-13 BLAST
low complexity region 813 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134865
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for the rd1 mutation have severe retinal degeneration and vision loss. Rod cells are lost by 35 days of age; cone cells degenerate slower and some light sensitivity persists. Other allelic mutations produce similar or milder phenotypes. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(9)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,919,646 W314R probably benign Het
Adgrv1 A T 13: 81,107,075 V6143E probably damaging Het
Agap3 C T 5: 24,477,817 T261I probably damaging Het
Ano6 T C 15: 95,913,957 I241T probably damaging Het
Arhgef28 T C 13: 97,939,543 T1328A probably benign Het
Capn10 C T 1: 92,939,383 R112W probably damaging Het
Car5a A T 8: 121,939,821 W46R probably damaging Het
Cntn6 C A 6: 104,833,103 T582K possibly damaging Het
Ctsh T C 9: 90,061,456 V60A probably benign Het
Ctsll3 A G 13: 60,799,596 F259L probably damaging Het
Fam228a T C 12: 4,737,725 E16G probably damaging Het
G3bp2 A G 5: 92,055,397 I388T probably damaging Het
Galnt5 A T 2: 58,038,937 K926N probably benign Het
Gm10097 G A 10: 5,069,485 probably benign Het
Gm9978 T A 10: 78,486,841 noncoding transcript Het
Gria1 A G 11: 57,189,733 T112A probably benign Het
Hnrnpk A C 13: 58,395,202 V134G probably damaging Het
Insr A G 8: 3,174,808 V220A probably benign Het
Lhx4 A G 1: 155,710,277 I96T probably damaging Het
Lrp1 T C 10: 127,583,876 T955A possibly damaging Het
Lrtm1 T C 14: 29,021,830 V85A possibly damaging Het
Man2a2 T C 7: 80,363,503 Y514C probably damaging Het
Npas1 T A 7: 16,463,262 D226V probably benign Het
Nrcam G A 12: 44,572,291 V858I probably benign Het
Olfr1462 T A 19: 13,191,311 S215T probably damaging Het
Olfr293 G T 7: 86,664,476 L271F probably benign Het
Pex1 T A 5: 3,624,487 N789K possibly damaging Het
Plekha6 A G 1: 133,260,101 D120G possibly damaging Het
Pomgnt1 A G 4: 116,153,913 T220A probably benign Het
Sdr39u1 A T 14: 55,897,907 I193K probably damaging Het
Sec61a2 C A 2: 5,886,557 M54I probably benign Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sra1 C T 18: 36,671,599 probably null Het
St5 A T 7: 109,557,271 C91S possibly damaging Het
Taf5 C T 19: 47,081,895 S640L probably damaging Het
Tas2r140 T A 6: 133,055,273 H174L probably benign Het
Tmem63a T A 1: 180,961,151 V351D probably damaging Het
Ttll7 C T 3: 146,944,092 Q626* probably null Het
Ubn2 T A 6: 38,463,982 V263E possibly damaging Het
Vmn2r106 C T 17: 20,285,405 W9* probably null Het
Xrcc3 C G 12: 111,807,972 C141S probably null Het
Zfp516 T A 18: 82,956,833 D385E probably damaging Het
Other mutations in Pde6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Pde6b APN 5 108426571 splice site probably benign
IGL01071:Pde6b APN 5 108419715 nonsense probably null
IGL01335:Pde6b APN 5 108423513 missense probably benign 0.03
IGL01611:Pde6b APN 5 108403396 missense possibly damaging 0.90
IGL01881:Pde6b APN 5 108421500 missense probably benign 0.01
IGL01941:Pde6b APN 5 108423036 missense probably benign 0.11
IGL02616:Pde6b APN 5 108431541 missense probably benign 0.05
IGL02657:Pde6b APN 5 108420276 splice site probably benign
IGL03217:Pde6b APN 5 108419566 missense probably damaging 1.00
Bemr28 UTSW 5 unclassified
D4043:Pde6b UTSW 5 108425356 nonsense probably null
N/A:Pde6b UTSW 5 108429103 unclassified probably benign
PIT4362001:Pde6b UTSW 5 108423585 critical splice donor site probably null
PIT4581001:Pde6b UTSW 5 108428508 missense probably benign 0.01
R0940:Pde6b UTSW 5 108420337 missense possibly damaging 0.95
R0963:Pde6b UTSW 5 108430668 missense probably benign
R1738:Pde6b UTSW 5 108430559 nonsense probably null
R1753:Pde6b UTSW 5 108388691 nonsense probably null
R1801:Pde6b UTSW 5 108427847 missense possibly damaging 0.51
R1913:Pde6b UTSW 5 108427190 missense probably benign 0.05
R2131:Pde6b UTSW 5 108428203 missense probably damaging 1.00
R2282:Pde6b UTSW 5 108423586 splice site probably null
R3713:Pde6b UTSW 5 108423062 missense probably damaging 1.00
R4385:Pde6b UTSW 5 108427642 missense probably benign 0.08
R4562:Pde6b UTSW 5 108403368 missense probably benign 0.23
R4582:Pde6b UTSW 5 108425231 critical splice acceptor site probably null
R4939:Pde6b UTSW 5 108421497 missense probably benign 0.01
R4950:Pde6b UTSW 5 108430703 missense probably benign 0.16
R4972:Pde6b UTSW 5 108425264 missense probably benign 0.00
R4983:Pde6b UTSW 5 108425330 missense probably benign 0.21
R5056:Pde6b UTSW 5 108423491 nonsense probably null
R5514:Pde6b UTSW 5 108423451 missense probably benign 0.06
R5528:Pde6b UTSW 5 108423558 missense probably benign 0.04
R6556:Pde6b UTSW 5 108421501 missense possibly damaging 0.56
R6826:Pde6b UTSW 5 108430592 nonsense probably null
R6884:Pde6b UTSW 5 108388708 missense probably damaging 0.99
R7213:Pde6b UTSW 5 108404090 missense probably damaging 1.00
R7444:Pde6b UTSW 5 108427142 nonsense probably null
R7690:Pde6b UTSW 5 108419518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTGATCCTGTCCCTTGTGG -3'
(R):5'- CAGCTGGACACTTTACGAGC -3'

Sequencing Primer
(F):5'- AGGTAATGAGGTCACTATGTTACTG -3'
(R):5'- GGACACTTTACGAGCCAATATTGTCC -3'
Posted On2017-02-28