Incidental Mutation 'R5937:Fam228a'
ID462334
Institutional Source Beutler Lab
Gene Symbol Fam228a
Ensembl Gene ENSMUSG00000079177
Gene Namefamily with sequence similarity 228, member A
Synonyms
MMRRC Submission 043242-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5937 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location4713670-4738430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4737725 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 16 (E16G)
Ref Sequence ENSEMBL: ENSMUSP00000152506 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000111154
AA Change: E16G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218905
Predicted Effect probably benign
Transcript: ENSMUST00000219898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220075
Predicted Effect probably damaging
Transcript: ENSMUST00000220978
AA Change: E16G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222363
AA Change: E16G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223500
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,919,646 W314R probably benign Het
Adgrv1 A T 13: 81,107,075 V6143E probably damaging Het
Agap3 C T 5: 24,477,817 T261I probably damaging Het
Ano6 T C 15: 95,913,957 I241T probably damaging Het
Arhgef28 T C 13: 97,939,543 T1328A probably benign Het
Capn10 C T 1: 92,939,383 R112W probably damaging Het
Car5a A T 8: 121,939,821 W46R probably damaging Het
Cntn6 C A 6: 104,833,103 T582K possibly damaging Het
Ctsh T C 9: 90,061,456 V60A probably benign Het
Ctsll3 A G 13: 60,799,596 F259L probably damaging Het
G3bp2 A G 5: 92,055,397 I388T probably damaging Het
Galnt5 A T 2: 58,038,937 K926N probably benign Het
Gm10097 G A 10: 5,069,485 probably benign Het
Gm9978 T A 10: 78,486,841 noncoding transcript Het
Gria1 A G 11: 57,189,733 T112A probably benign Het
Hnrnpk A C 13: 58,395,202 V134G probably damaging Het
Insr A G 8: 3,174,808 V220A probably benign Het
Lhx4 A G 1: 155,710,277 I96T probably damaging Het
Lrp1 T C 10: 127,583,876 T955A possibly damaging Het
Lrtm1 T C 14: 29,021,830 V85A possibly damaging Het
Man2a2 T C 7: 80,363,503 Y514C probably damaging Het
Npas1 T A 7: 16,463,262 D226V probably benign Het
Nrcam G A 12: 44,572,291 V858I probably benign Het
Olfr1462 T A 19: 13,191,311 S215T probably damaging Het
Olfr293 G T 7: 86,664,476 L271F probably benign Het
Pde6b G T 5: 108,424,327 A478S probably benign Het
Pex1 T A 5: 3,624,487 N789K possibly damaging Het
Plekha6 A G 1: 133,260,101 D120G possibly damaging Het
Pomgnt1 A G 4: 116,153,913 T220A probably benign Het
Sdr39u1 A T 14: 55,897,907 I193K probably damaging Het
Sec61a2 C A 2: 5,886,557 M54I probably benign Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sra1 C T 18: 36,671,599 probably null Het
St5 A T 7: 109,557,271 C91S possibly damaging Het
Taf5 C T 19: 47,081,895 S640L probably damaging Het
Tas2r140 T A 6: 133,055,273 H174L probably benign Het
Tmem63a T A 1: 180,961,151 V351D probably damaging Het
Ttll7 C T 3: 146,944,092 Q626* probably null Het
Ubn2 T A 6: 38,463,982 V263E possibly damaging Het
Vmn2r106 C T 17: 20,285,405 W9* probably null Het
Xrcc3 C G 12: 111,807,972 C141S probably null Het
Zfp516 T A 18: 82,956,833 D385E probably damaging Het
Other mutations in Fam228a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Fam228a APN 12 4732773 missense possibly damaging 0.94
IGL01472:Fam228a APN 12 4715610 missense possibly damaging 0.64
IGL02602:Fam228a APN 12 4732808 missense probably benign 0.00
IGL02797:Fam228a APN 12 4731484 missense probably damaging 1.00
IGL03247:Fam228a APN 12 4737734 missense probably damaging 1.00
R0332:Fam228a UTSW 12 4735018 missense probably damaging 1.00
R0437:Fam228a UTSW 12 4732759 missense probably damaging 1.00
R0454:Fam228a UTSW 12 4731457 missense probably damaging 1.00
R0838:Fam228a UTSW 12 4735002 missense possibly damaging 0.92
R1791:Fam228a UTSW 12 4732748 missense probably damaging 1.00
R1836:Fam228a UTSW 12 4715620 missense probably damaging 1.00
R2256:Fam228a UTSW 12 4737775 start gained probably benign
R2257:Fam228a UTSW 12 4737775 start gained probably benign
R2397:Fam228a UTSW 12 4718718 missense probably benign 0.22
R3731:Fam228a UTSW 12 4718671 missense probably benign 0.44
R3921:Fam228a UTSW 12 4731506 missense probably benign 0.02
R7278:Fam228a UTSW 12 4732790 missense probably benign 0.01
R7610:Fam228a UTSW 12 4731423 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCCTTGAAGTACTTTCACCC -3'
(R):5'- GCAACCAGTAATGCTATCTCCTTC -3'

Sequencing Primer
(F):5'- TTGAAGTACTTTCACCCGAGAAAC -3'
(R):5'- AGTAATGCTATCTCCTTCTGTCCCAG -3'
Posted On2017-02-28